header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-120213-413
Transcript Name: cd109-201
Previous Names: cd109-001, si:zfos-875e8.2-002, zfos-875e8.2-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000052861 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000052861|OTTDARG00000037108|ZDB-GENE-120215-253 cd109|OTTDARP00000041563 cd109-001 LG_none CU855808.6,CU525921.4 Danio rerio protein_coding PUTATIVE, 4036 bp
ACTGGAGACTAGCACCTGAAAATGGAGTGGCTTCAGTTCT
TTGGGATCCTGGTGTGTTCACTGGTCTGCAGAGGAGCGAT
GGTTACATCAAGCGCTCGTCAGAACCTCTCCTATCTCATA
TCGGTGTCTGAAGTTCTGCGCTGTGGCGTTCCCACCACAT
TATCAGTCACCGTTCTGTCAGATTATCCCATCAATGTCAC
AGCCAGACTTACTCATGGAAAGACCAGTGTGGCCCAAACA
CAGAGCACCGTCCCAGCAGGCTCCAGCAGACTTCTGTCTC
TCCCACCTGTGTTTTATGATGACATGACTTACTGGTATCC
GTATCAGCTGAATGTGGAGGGCTTTTCAGGAACTCATCTT
GTGTTTTCCAACTCCACCTCCATGGTCTTTAGCCCCAGGT
GCATGTCCATCTTTATTCAGACCGACAAGAACTACTACCA
ACCCGGACAGACGGTCAAATTTCGAGTTGTATCAGTTACT
CCTGATGGAAAGCCGTACAGCGGTCGGACTGATATTTTTA
TAAGGGATCCCAGGGGGAATATGATTCGCCAGTGGCTCGC
TGTGGATAGTTTTCTAGGCGTCATTTCTAAAGAGCTGAAC
ATCTCTCAGAATCCACCGCTCGGATCCTGGAAGATTACAG
CTGGAGTCAATGATGTTATTCATGAGAGAGCGTTTACTGT
GGACTACTATGTACTTCCTAGATTCGAGGTGAAGCTGGAC
GTTCCCTCAGTCCTGTATTGTGAAGACACACTCATGGGGA
CGGTCACAGCCAAATATTTTTATGGGAAGCCTGTCAGTGG
GTTTATGGATGTTAGATTTGTTCATGGTTTTAACGGCATT
GAAATGCGATATGACCACACAGAAATGATAGAGGGCTCTG
CTGAAATCACTTTTGACATGAAAGACTTTTCCACACGGTT
CAATGATTATTCATATTCATATTATGACGGCTACAGACCC
ATTGAATTTATCGATGTTAATGTGAACATCACAGAGAGTG
CTACGGGTTTAATGTACAACAGCAGCGCAAGGGTTTCCAT
TGTGACAGAAAAATATAAGCTAGAGTTTTTGCAATATCCA
CATATCGTTAAACCCTCCATGACCTTCACCGCTAAGCTGA
AGTTGAGTCTGTATGACCAGCGGCCGCTATCTGCTGAGGA
TCAGATTGAAAGTGTTTATCTGGCAGTGACGCAGCACAAG
CTCAGCCCCTGGACGTGGATGTGGAGCGATGGAGGACCTC
TAGGGCCTCGTATGATGAACAACACACCCTCCACGAGCTT
CCCTCCTAACAGTGACGGAGGACCTCTAGGGCCTCATATG
ATGAACAGCACTCCTCCCACCAGCTTCACTCCCATCTACG
ACCTCCCTGTCCAGAACATTGAGCTTCCGGTCACTGCTGA
CGGCCTGATGTCCTTCCAGATCCACCTCTCAGACAGTGTG
GCCACTCTGGATCTAGAGGCACGGTTTAAAGACACGGTCC
AACATCTTCAGCTCTACAGGAGTTATTCTTCACCAAGTAA
ATCCTACATTCAGCTTCACAGAGACAGCGAGCCTCAGGTT
GGACGGTCACTGAATTTCACTTTGGAGAGCAGCTTTAACT
TGACCAAAATCCACTACCTTGTGACGTCTCGCGCTGGAGT
GGTGGATGCTGGGACGGTTCAGTCTTCCTCCTTCAGTCTG
AACACAGATCACCTATGGGCTCCCCAGGCCTGTGTGATGG
TTTATTACACACTTCCAGATGGAGAGATCGTGAATGACGC
TCTACACGTCTCTTTCACAAAAGTGCTCAGAAACACAGTT
TCTGTGCGCTGGAGTCAGGATCGTGCAGAACCAGCAGAAT
CCGTGTCTCTCTCCGTTTCTGTATCCGAACCTGGATCTGT
GCTGGGAATCCTGGTGGTAGACAAAGCCACGCTGAACTCA
GCTGAAGACAATGGCCTTTCGGAGAAGACGGTGCTTGAGG
AATTTCTGTCGTACAGCAGGGAGATGACCCACACGGATAA
CAGAGGCATGAAAATGGGAGATCCGTATTCTGTATTCACG
GCTTGCGGCGTCACGGTTCTGACTGATGCCAGGCTGAATC
AGGAGATGGCGACCAATCAGGAGATGTTTCCAATGTTCCC
AGGGGAGGAGGGACTCTTTATGACTGCGATGCCTGACAGC
AGTATTCAAGAGCCCAGACAGAGAAAAGACTTTCCTGAAA
CCTGGATCTGGCTGGATGCTAATGTGAGTGACTCTGCTTC
AGCTGTTTTCTCCTTGACCGTGCCAGACAGTCTGACCTCA
TGGGCGGCTTTTGCTATCATCATGTCTGAGAATCTGGGTT
TGGGCATCAGCGCTCCTGCAGAGCTGACAGTGTTCAGAGA
TTTCTTCATGTCACTGGACCTCCCGGCGTTTCTCATCCGT
GGAGAACTGCTGCTGCTTGAAGTCAATTTATTCAACTATA
TGGATGTAGATTTGGAGGTGATTGTAGTTGTTGCAGAAAG
CGGGATGTTTGAGTTTGTGTCAACAGACAGCGCAGATTTT
TCTGTGGCCAACGTGAGGAAAGTGTTGGTGTTGAGTCAGA
ACTTCACCATGCTTCTGTTCCCCATCAAAGCCACGACGCT
GGGAGAAATTCCCATCTCTGTCAAAGCCACGTCCGTCTAC
TCTTCAGACTGGCTCTACAAAACCGTTCTCGTCAAGCCAG
AAGGACTGCAGCAGTCATTCACTCAGACCTTGTTCCTGGA
GTTTCTTCTGCAGCAGCACACACTGTCCAGGAAGATGACC
TTCAGTTTCCCTGCAGATGTGGTTCCTAATAGTCAGAGGG
CCAGTGTTTCTGCTGTGGGTGACATTCTGGGCCCATCCAT
CGGCAATCTGGACTCCCTCATTGAAATGCCTTACGGTTGT
GGTGAGCAGAACATGATCCATTTTGCTCCAAATACCTATG
TTCTCCAGTATCTTAAAAGCACCAAGCAGGCTGAAGAACA
GACTAGGAGGAAAGCTATGAGCTATATGATGGAAGCTTAT
GAGCGTGAGCTTTCCTACCAAAGGGTTGACGGTTCTTTCA
GTGCCTTTGGAGACAGCGATGAATCTGGCAGCACGTGGCT
GTCAGCGTTCGTGCTCAGGTGTTTTCTCCAGGCTCGGGAC
TTCATTTCCATTGAGCCCTTGGTGATGGAAAGGACAGCAT
TTTGGCTGGTGGCCCATCAGGAGTCGGACGGTTCATTCAG
AGAGCCGGGTCAGGTCATCCACACTGAGCTACAGGGAGGA
CTGGATGGATCGGTGTCTCTCACTGCATATGTTCTAATAG
CGCTTCTGGAGGACGCCAAATATGAGAGCACACATAAAGA
CAGTGTGTCTTTAGCCTTGAGTTTCCTGACGTCTCGTCTA
GCTCAGGGAATCTCCAGTAACTACAGCTTGTCTTTAGTGG
CCTATGCTCTGTCACTGGCCAAGAGCAGCGCCGCTCCATC
TGCCCTCACCACACTGCTGAACAGAGCACTGGTCATTGAT
GGAGTGCCAACATGGAGATCTCCAGGCAGCGTTCTGTATG
ATTCCTGGCAGCCGCGTTCAGCAGATATTGAGATCGCTGC
TTATGTCCTGCTCACCATGCACAGTCTCAGACTAATGGAT
GAAGGATTTGCTCTGATGAAGTGGCTCAGTCAGCAACGAA
ACCATCTTGGGGGATACGGATCCACTCAGGATACAGTGAT
GGCGTTGCATGCGCTGTCGGTTTACGCCACCTTCAGTAGC
GCAGAGTCCATGGATCTCACCATCAGAGTGAATGAAGGCT
CCGGCACTGTGGCCACATTCAGCATAGACAAATCCAACTA
CCTGCTCCAACAGAGCCACGACCTGCCCATCGAATCTAAA
GATGGGGTTGACATTGAAGTGGAGGCAGAGGGCACAGGCT
TTGCTCTGTTTCAGCTTACTGTGTTCTACAACGTGATGAA
TGTGAGAAGATCGCTGAGACGGCGTGACATTCACACAGAC
GAGGCCTTCTACTTGTATGTGGACATCATGGATAAGGAGG
AGTATCATGTAAACCTTTACACATGTTTCAGGTGAG

cd109 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA cd109-201 4036
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cd109-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000052861 (1),  Ensembl_Trans:ENSDART00000151435 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:AW077921 (1) 706 bp
GenBank:AW233290 (1) 625 bp
GenBank:AW232793 (1) 537 bp
CITATIONS (2)