Transcript

pknox1.1-201

ID
ZDB-TSCRIPT-120213-380
Name
pknox1.1-201
Previous Names
  • ottdart00000054891
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000054891 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000054891|OTTDARG00000038306|ZDB-GENE-020122-5 pknox1.1|OTTDARP00000043056 pknox1.1-001 LG_ BX294175.5 Danio rerio protein_coding KNOWN, 2337 bp
AGTGTGACGAAGATTGGCACCCAGGTCCTCTCCTGCTGCC
TGTCCATATAATGTCCCAGTGTTGGCAGTGGCCATTTTGA
ATATGATGGCTGCCCAGTCTGTGTCCATAGACAAATACCC
AGAGGGAGACCAGCAGATGCAGGTAATGGAGCAGTCAGAG
AATGACCTTAAAAAGGGCTTTTCCAATGGAAACACAGGAA
ACACAAGCAGCCCTGTATCCAATGAACCACAAACACAAAT
GGATATCGACAAAGCCTGTATATATAGACATCCTCTTTTC
CCTCTCCTGGCTCTCCTGTTTGAGAAGTGCGAACAGTCCA
CTCTGGGGTCCGACTGTGTCACGTCTGCCAGTTTCGATGT
TGACATTGAGAACTTTGTACGCAGTCAAGAGAAAGACGGC
AAAGCCTTCTTTAGTGAAGACCCTGACCTCGACAACTTGA
TGGTCAAGGCCATCCAGGTGCTGAGGATTCATCTGTTAGA
GCTGGAGAAAGTCAGTGACCTGTGCAAGGATTTCTGCAGC
CGTTATATTTCATGCCTTAAGGCCAAGATGAACAGCGAGA
CACTGCTGAGTGGAGATCCAGGCAGCCCGTACTCTCCGGT
CCATGACCAGTTGTCCAACCCTTTCTCAGGTCCCCTCAGT
CCCCAGAGTCTTCTGATACCTTCGTCTGGTCTTCAACAAG
GCAGTGTTACAGTGACCACAGTCAATTCATCACAAGTGGC
CACAGGTAACACCGTATATCAGCCAGTGACAGTGGTCACA
CCACAGGGACAAGTGGTGACACAGGCCATCTCACCTGGAG
CACTACACATCCAGAACTCACAGCTCCAACTTCAGCTCAA
TCAGGACTTGAGTTTCTTCGGGGGAGACGACAGCTCACCT
AAAAACAAACGTGGCGTTCTTCCCAAACAGGCAACCAATG
TCATGCGCTCCTGGCTCTTTCAGCACATTGCGCACCCGTA
TCCCACTGAGGAAGAGAAAAAGCAAATTGCAACTCAAACA
AACCTGACTTTACTTCAAGTCAACAACTGGTTTATTAATG
CTCGAAGACGAATACTGCAGCCAATGCTGGATGCCAACTC
AACAGAGGCATCTAAAAGCAAGAAAAAGGTGGCTCAGAGT
CGCCCGCTGCACCGCTTCTGGTCCGACTCCATCGCCTCTA
CAGGAAGCCAGCAGCAGCTCACAATGCCAGACGGGAGTTT
GGTTACTGTGGGAATGAATGTTGACGGCTTCCAGGCGCTT
TCTTCAGATGGAGCCACTCTCGCCATGCAGCAGGTCTTGA
TGGGAAATCACAGCGAGGATGAGACTGATGAAAGCGGCAA
TGAAGACGACACAGATATGTCAACCGCCAACATGCCCGGT
CTGGGTTTAGACGTCAGCGACTAAGACGCATGGATTGCAG
GTCACACACTGCATGCTTACATTTACATTGGAAAACTTGC
AGATGATGCTTGTTGCAAGAGATCCGCTCCCTATGTAGAT
TTTCAGCAAAGCTGATACTTGTGCACTACAAAAAGAATTA
AGTACTGTATGTTGACCTTTATGTTACACAAAACACAAGT
GAACAGTTTACAGAGAGCACAACGTTACTGAAAGCAGCAA
ACCGAGGAGTGTCATTTTTACCACAAAGAGGTTTGTGCAC
TTTTATACAGATACACTTGGAGAAGACTGCAGAAATGGAG
GACGGAGGAACCTTTTGAAACTCCTTTAGTGAATGTTTGG
TCAATTTTGTTTTCTGTATTAACTCATTTGGATGCCAAGA
GTGTGTCGTCGTGCTGGTTTTATTCCCACTGCATGTTTGT
GTTCTCTTCAGTATGCTCACGCTTGTAGAGACTCCAAGAC
GGAGTTTGAGAAAAGAGATTATTTTTATATATAAACGTTG
TATAAAAGTGTTGTTTTTCTTTTGCTGTTTTTTTTAGTGT
TTTATAGGGAATATTTATGTACAGAAACGATACTATCTGC
CCTGTTTTCAGGGGATGAGTTTTTCTTCTTGTTTTTAGAA
AAACAAACAAAAAAAAGATCTTGGAGTTAAACCATTGTTT
CAATTTGTGAATTGGTTTTAACACTCGCGTACAAAATGCC
TTACACGTCCTTTTGTAAAACTCTTTTGCTGATAAGCACA
GAAATCCGGATGCATTGATGAAATTGAGTAATATCTGTTC
AAGTCTCTTCCAGTAATCTTTCCTTCGTTTCAGAGGGATC
TCTGTTTTTGCTCTGTAGGCTGATGTAGTTTGATCTCACA
TGTGCAAAGCTTATCAATCAGATTCATGAAAGAAGCTTTG
GAAATGAAAATGGCATAAAATGTCCATTATTGAAGTCAAA
TAAAGGTCAAGTCTGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations