ZFIN ID: ZDB-TSCRIPT-120213-378
Transcript Name: si:ch211-173n18.5-001
Previous Name: ch211-173n18.5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: antisense
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000054836 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000054836|OTTDARG00000038270|ZDB-GENE-120215-194 si:ch211-173n18.5|no_translation CH211-173N18.5-001 LG_ CR388364.11 Danio rerio antisense NOVEL, 784 bp
TCAGGACCCTCTTTGACTCTTGCAGAACTTTGTTGGTGTC
TTTGACCGAGCACAGAACCAGAGTGCAAACCACAGCATCC
ACCGAGCTGTCCTCCACTGCCTGCAGATTCTCCCCCGACG
CCACTATGAAGTTGTCGTACTCCAGGTTGTCATAAACTTA
CAGGCCTCAGGACCCTCTTTGCCTCCTGCAGAACTTTGTT
GGTGTCTTTGACCGAGCACAGAACCAGAGTGCAAACCACA
GCATCCACCGAGCTGTCCTCCACCGCCTGCAGATTCTCCC
CCGACGCCACTATAAAGCTGTCGTACACCAGTGGCTTCAG
TGAGCAAACACTGTCATGGCTGGTGGTGCATTGCACAGCA
AGGCTTCGTCCACTTGAGGCTCATCAGCGAGGACTGGAAA
AGATGCTCAAGTGGCCCAGAAGGGGGAGTTGATGTAGGCT
GAAAGTCTAAAGCTGTTGTTTCCTTTCACCTCCTAACAGG
ATTAGAGGAAGATTAACTACTGCCCGCAACCTTTGACCAC
ACAGTATCTGCTTCCATGACTGCACTCCCACAGGGCTTGA
ACCATATCCTTAAAAATGTAGGACGTTTTTACAACAGTGC
CCTAGAAGTATTGTTTTTGGTTCTCTGAAGAACTTTATTT
TTATTTATCTTTTATTCTCATGTGAAGGACAAATGTTTTA
TGCATATTAATGATTTCTCATTTAACCACACTAAGAGATT
ATTATTATTAATTATCAGGTTCTGTATATCTTTTGATAGA
TTTTTCTCATTTGTTTATGGCTAT

si:ch211-173n18.5 TRANSCRIPTS
Type Name Length (nt) Analysis
antisense si:ch211-173n18.5-001 784
si:ch211-173n18.5-002 (1) 537
si:ch211-173n18.5-003 (1) 511
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-173n18.5-001 Contained in:
[BAC] CH211-173N18 (1)

Genome Resources: Vega_Trans:OTTDART00000054836 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:DT078727 (1) 758 nt
GenBank:DR724562 (1) 742 nt
CITATIONS (1)