ZFIN ID: ZDB-TSCRIPT-120213-1149
Transcript Name: si:ch211-173n18.5-002
Previous Name: ch211-173n18.5-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: antisense
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000054838 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000054838|OTTDARG00000038270|ZDB-GENE-120215-194 si:ch211-173n18.5|no_translation CH211-173N18.5-002 LG_ CR388364.11 Danio rerio antisense NOVEL, 537 bp
ACTTTGTTGGTGTCTTTGACCGTGCACAGAACCAGAGTGC
AAACCACAGCATCCACCGAGCTGTCCTCCACCGCCTGCAG
ATTCTCCCCCGACGCCACTATGAAGCTGTCGTACACCAGA
ACTTTGTTGGTGTCTTTGACCGAGCACAGAACCAGAGTGC
AAACCACAGCATCCACCGAGCTGTCCTCCACTGCCTGCAG
ATTCTCCCCCGACGCCACTATGAAGTTGTCGTACTCCAGG
TTGTCATAAACTTACAGGCCTCAGGACCCTCTTTGCCTCC
TGCAGAACTTTGTTGGTGTCTTTGACCGAGCACAGAACCA
GAGTGCAAACCACAGCATCCACCGAGCTGTCCTCCACCGC
CTGCAGATTCTCCCCCGACGCCACTATAAAGCTGTCGTAC
ACCAGAAGGTGTGATCACGTGAAGATGCCTCTGTGTTCTG
TCTGGCTTCTTTTTAAAGTGGCTTCAGTGAGCAAACACTG
TCATGGCTGGTGGTGCATTGCACAGCAAGGCTTCGTCCAC
TTGAGGCTCATCAGCGA

si:ch211-173n18.5 TRANSCRIPTS
Type Name Length (nt) Analysis
antisense si:ch211-173n18.5-001 (1) 784
si:ch211-173n18.5-002 537
si:ch211-173n18.5-003 (1) 511
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-173n18.5-002 Contained in:
[BAC] CH211-173N18 (1)

Genome Resources: Vega_Trans:OTTDART00000054838 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AL922739 (1) 539 nt
CITATIONS (1)