ZFIN ID: ZDB-TSCRIPT-120213-312
Transcript Name: arf3b-201
Previous Name: ottdart00000054398

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000054398 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000054398|OTTDARG00000037992|ZDB-GENE-030616-356 arf3b|OTTDARP00000042730 arf3b-001 LG_ AL953886.9 Danio rerio protein_coding KNOWN, 645 bp
ACACAAAGGACTCGCAGCTTTAAGGACGAAGTAAAACATT
GAATCATGGGGAATATTTTTGGCAATCTGCTGAAGAGTCT
GATAGGAAAGAAGGAGATGAGAATTCTGATGGTTGGACTT
GATGCTGCTGGTAAAACCACCATCCTTTACAAACTGAAGC
TGGGAGAGATCGTCACCACCATCCCAACCATCGGCTTTAA
TGTGGAGACAGTGGAGTACAAGAACATCAGCTTCACTGTG
TGGGATGTTGGTGGTCAGGATAAAATCAGGCCGCTCTGGA
GACACTACTTTCAAAACACACAGGGTCTGATCTTTGTGGT
GGACAGCAACGACCGGGAGCGGGTGAACGAGGCCCGAGAG
GAGTTGATGAGGATGCTCGCAGAAGACGAACTTCGTGACG
CTGTTCTTCTCGTCTTCGCAAACAAACAGGATCTGCCAAA
CGCTATGAACGCTGCCGAGATCACAGATAAACTGGGCCTT
CACTCGCTCCGCCATCGTAACTGGTATATACAGGCGACCT
GCGCGACCAGCGGCGACGGCCTGTACGAGGGACTCGACTG
GCTCGCCAACCAGCTCAAGAACAAGAAGTGAGGCCGGGTT
TTCATTATGCGGCGCTTTGGGAACGGGTGGGATTAATTTG
GCCTT

arf3b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA arf3b-001 (1) 1038
arf3b-201 645
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
arf3b-201 Contained in:
[BAC] CH211-241A17 (1)

Genome Resources: Vega_Trans:OTTDART00000054398 (1),  Ensembl_Trans:ENSDART00000053775 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC163292 (1) 645 nt
GenBank:BC163310 (1) 645 nt
CITATIONS (2)