Transcript

arf3b-201

ID
ZDB-TSCRIPT-120213-312
Name
arf3b-201
Previous Names
  • ottdart00000054398
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000054398 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000054398|OTTDARG00000037992|ZDB-GENE-030616-356 arf3b|OTTDARP00000042730 arf3b-001 LG_ AL953886.9 Danio rerio protein_coding KNOWN, 645 bp
ACACAAAGGACTCGCAGCTTTAAGGACGAAGTAAAACATT
GAATCATGGGGAATATTTTTGGCAATCTGCTGAAGAGTCT
GATAGGAAAGAAGGAGATGAGAATTCTGATGGTTGGACTT
GATGCTGCTGGTAAAACCACCATCCTTTACAAACTGAAGC
TGGGAGAGATCGTCACCACCATCCCAACCATCGGCTTTAA
TGTGGAGACAGTGGAGTACAAGAACATCAGCTTCACTGTG
TGGGATGTTGGTGGTCAGGATAAAATCAGGCCGCTCTGGA
GACACTACTTTCAAAACACACAGGGTCTGATCTTTGTGGT
GGACAGCAACGACCGGGAGCGGGTGAACGAGGCCCGAGAG
GAGTTGATGAGGATGCTCGCAGAAGACGAACTTCGTGACG
CTGTTCTTCTCGTCTTCGCAAACAAACAGGATCTGCCAAA
CGCTATGAACGCTGCCGAGATCACAGATAAACTGGGCCTT
CACTCGCTCCGCCATCGTAACTGGTATATACAGGCGACCT
GCGCGACCAGCGGCGACGGCCTGTACGAGGGACTCGACTG
GCTCGCCAACCAGCTCAAGAACAAGAAGTGAGGCCGGGTT
TTCATTATGCGGCGCTTTGGGAACGGGTGGGATTAATTTG
GCCTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations