ZFIN ID: ZDB-TSCRIPT-090929-22861
Transcript Name: arf3b-001
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: AB
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000001490 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000001490|OTTDARG00000001381|ZDB-GENE-030616-356 arf3b|OTTDARP00000001308 BUSM1-202L16.1-001 LG_ AL591389.5 Danio rerio protein_coding NOVEL, 1038 bp
AAAACATTGAATCATGGGGAATATTTTTGGCAATCTGCTG
AAGAGTCTGATAGGAAAGAAGGAGATGAGAATTCTGATGG
TTGGACTTGATGCTGCTGGTAAAACCACCATCCTTTACAA
ACTGAAGCTGGGAGAGATCGTCACCACCATCCCAACCATC
GGCTTTAATGTGGAGACAGTGGAGTACAAGAACATCAGCT
TCACTGTGTGGGATGTTGGTGGTCAGGATAAAATCAGGCC
GCTCTGGAGACACTACTTTCAAAACACACAGGGTCTGATC
TTTGTGGTGGACAGCAACGACCGGGAGCGGGTGAACGAGG
CCCGAGAGGAGTTGATGAGGATGCTCGCAGAAGACGAACT
TCGTGACGCTGTTCTTCTCGTCTTCGCAAACAAACAGGAT
CTGCCAAACGCTATGAACGCTGCCGAGATCACAGATAAAC
TGGGCCTTCACTCGCTCCGCCATCGTAACTGGTATATACA
GGCGACCTGCGCGACCAGCGGCGACGGCCTGTACGAGGGA
CTCGACTGGCTCGCCAACCAGCTCAAGAACAAGAAGTGAG
GCCGGGTTTTCATTATGCGGCGCTTTGGGAACGGGTGGGA
TTAATTTGGCCTTTGGAATCGTTACGTTTGTTCTTTTGCT
TTGGATTATTTTGTGTTGAATTCTGGGAAATACAGTGTGT
GTGGTTTATAGAGCCTTAAATGCTCTGTGTAAATCATCTG
TATGTTTGTATGTACACACAGACAAAACAAAACTGATTTT
GTCGAAATATTGATATACATCTGATTTAGTCATTTTTTTC
TGTATAATGAACTGCCGTCAGTATTTACAGTACAGTGCCA
TTCACTAATGCTGGTAATCTGAGTAAATACGTCTTTTTGT
TGAACCTTTTGCTCAGAATATTAAAAGAAAATTAAAATAT
TGAAGGGAGAGTTCACTCAAAATGAAAATTCTGCCATCAT
TTACTCTCATCTTTCAAGTGTTTCAAGCCTGTTTGAGTTT
CTTTTAGTATAACTAAAATAGTTATACTGAAGAATGCT

arf3b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA arf3b-001 1038
arf3b-201 (1)    Ensembl 645
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
arf3b-001 Contained in:
[PAC] BUSM1-202L16 (1)

Genome Resources: Vega_Trans:OTTDART00000001490 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BI475336 (1) 559 nt
GenBank:BI981543 (1) 536 nt
GenBank:BI429288 (1) 526 nt
GenBank:BI839547 (1) 492 nt
GenBank:BM024462 (1) 461 nt
CITATIONS (1)