ZFIN ID: ZDB-TSCRIPT-120213-302
Transcript Name: rgl3a-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000054344 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000054344|OTTDARG00000037952|ZDB-GENE-101130-1 rgl3a|no_translation rgl3a-002 LG_none CR627490.6,CR394534.6 Danio rerio protein_coding KNOWN, 320 bp
CGGGGTTATCCATTCACTGTTGACATCACAGTCAGGTTTA
ACACGAGCTGACTAAGGAATATTTTCTCTAAACCTTGTTT
ATTTTTTGCTGTGTTAATGGAAAGTCGAGACGCTTACATT
TCTCGATCATACCACTGAAGGATACAGAGCCGCAAACATG
GGGAAATGGGAGCTGACGATGGACCCGGTGCAGGAGTGGG
GAGAGGAGGTGGAAGACGGGGCAATTTATGGGGTCACCCT
TCACCGAGAGCCTATCCAACCTCCACCTGACGCTAGTGAG
AGCGATGCCGCCTTTGGCTTCATGCAGTACCGCACACTGA

rgl3a TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA rgl3a-002 320
rgl3a-003 (1) 740
mRNA rgl3a-202 (1) 3567
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rgl3a-002 Contained in:
OTHER rgl3a-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000054344 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CD585740 (1) 324bp
    CITATIONS (1)