ZFIN ID: ZDB-TSCRIPT-120213-1072
Transcript Name: rgl3a-202
Previous Name: rgl3a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000054343 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000054343|OTTDARG00000037952|ZDB-GENE-101130-1 rgl3a|OTTDARP00000042691 rgl3a-001 LG_none CR627490.6,CR394534.6 Danio rerio protein_coding KNOWN, 3567 bp
AAGATGGCGGCGCGGCTTGTAAAACGGAAAACGGAGGCCT
GTTTCTTTGTTTACATCGGTGAGACCTTCAGATTACAAAC
ATTTTTTAAAGGAGCTGATCTACAACCAACAGATTCTGGA
TAAGCAGCAGGTTACACATCATCGTGTGTTTGGGCTGGAG
GAGGATGCGGTCTTGTCTGCTGGTGTCTGGAGGAGAGAAG
GGTCTGCGGGCGCGACTGGGGCGAATGCGGCAGCTGCTAT
GCCAGACGGATCATGTGGAGATTCAGGTGGACGAGGAGCC
CGGCGTTTGGCTTAGAAGCTTCCATCTGCTGGATCTGCAG
GAACACACTGAGGACCCGGTGCAGGAGTGGGGAGAGGAGG
TGGAAGACGGGGCAATTTATGGGGTCACCCTTCACCGAGA
GCCTATCCAACCTCCACCTGACGCTAGTGAGAGCGATGCC
GCCTTTGGCTTCATGCAGTACCGCACACTGAAGGTCCGCA
GGCTGAAAGCAGCCACTCTGGATCGCCTTGTCACAGAATT
AGTGAACCCGGAGTGCCCTGACCCAGACTACATGCATATC
TTCCTCTCTACTTACAGAGCCTTTACCTGCACAAATGCTC
TCATTGAGCTCCTTTTTCAAAGAGAGGACATGGTCACCAA
TCTGAACAACAGTGTCTGTGTCAAGAGCTCTCTACCTCGT
CTGATCAGACTCTGGTTAGACGAGTTTCACGAGGACCTTC
GGGACTCTCCGGATCACCAGGCTCTTCGGCTGCTCTGCGT
TCATCTGCGTCATCGCCTCTGTTGCAGACGTCTGGTTAAC
CAAGCCGATGCTCTTCTTAGAAAGTTTCAGACTGAAGACA
AGCAAATATGTACATCAGCAGAGGTCAATGCCTCTGCTGT
TGAGAATCCTGCAACTGAAGACAACTTGGACGGACAGGAA
GTACAAGAAATTGGTGATGTACTGGACTTCCCTGCACAGG
ACATTGCCGAGCAGCTTACAATATTAGACGCAGAACTTTT
TAGCAAAGTGGTCCCATTTCACTGCCTTGGCTGCATTTGG
TCTCAAAGGGACAAGAAGGAAAACCAGAATCTAGTGTCCA
CAGTCCGTGCCACCATTGCTCAGTTTAATGTGGTCACTAA
CTGCGTTATCACCTCGCTGTTGTGTCCTCCTGCCACCTCC
CCTCCTGGATCCCCGTCATGCCATCGCAGCAGCCCTACAT
ACAGAGCAAAGATTATCGAGAAGTGGATCTCTGTGGCTCA
GGAGTGCCATCAGCTCAGAAACTTCTCCTCTCTAAGAGCC
ATCCTGTCTGCTCTTCAGTCAAATGCTGTCTACCGGCTGA
AGAAAACCTGGGCTGTGATCAGCAGGGAGAGTATGGCTGT
CTTTGAACACCTCTGCGACACCTTTCCTGATGAGAACTGT
GTGCTGATCAACCGAGAGATCTTAGTAGAGGAGGGAAACC
AGGCAGCGGATGTAGAAACTCACTCTGCTCCAAAGTCTCC
CAGACTCAGTCCTACGTGTAAGCACATGAGCTCGTCCAGT
GGTGAGGTGCCGTACCTGGGCACTTATCTGACCGTTCTCA
CCATGCTGGACACAGCGCTGACTGACAATGTAGAGGGAGG
CCTCATCAACTTCGAGAAGCGACGAAAAGAGTTTGAGATT
CTGTCTCTAATCAGGCAGCTGCAGGCGTCATGTGCTCACT
ACACTCTCCAATCACATCCTCGCATCATTTCCTGGATCAA
CAGCAGCATGAGTCTTTCTGATCAGAAGAGCTATGAGTTG
TCAAGAGAGCTGGAGCCCCCAGTTGACCCCTGTCCCAGCT
CTCCAAACTCCTGGAGTCACAGGCTCATCGCCAAGAAACT
GAATTTATTGCTGTCTGCCACTGAGAACTTCTCAAGGAAA
ACTCTTGCCGATCAAATCAGCGTGTCGTCCTCAGGCTCCA
GCGGCTCAGACATGGAGGATCTCGGCAGAGATCTCAGCAG
CCCCAACACCTCACCTCTTGTGTATAAGTCACCGTCAGTT
TCCTGTCAGGACATCTCGGTAGACACGCCAACCTCATCTC
CGACTCCACCACCTTCCTGTCAAAGATCCCTACAGGCAGA
TCTGCCTGAAAGCCCCTCCTCTACTTCATCATCATCTTCA
TCATCCTCTCCATCCCTACATCAACGCTGTGCTCTGCATC
CCATGTACAACAAGCAGGTTGCAGATTCCTGTATCGTCAG
AGTCAGCGTGGAATTTGGCAACAATGGAAATGTTTATAAA
AGTATTCTGATAACCAGTCAGGACAAGACAGCTCAGGTGG
TTCAGAGAGCTCTGGAGAAGCACAACCTGGAGGAGATGAA
CTGCCAAGATTTTACTCTCACACAGGTGCTTTCTAACGAC
AAAGAGTTGCTGATCCCAGACAAGGCCAACGTGTTTTATG
CCATGTGCACCACTGCCAACTATGACTTCGTGCTCCGTCA
GCGTTACAAACACCTCAGTAGAGCCACCGGACCATCCTGG
AGTCCAGGAGCAGTGGTGAGGAGCCGCAAATAACCTACAT
GACAAAAAAATAATAAATTAAACTGCATAGAACAAACAGT
CTGTTCACAAATACTAAGCTGATGAAATGGGGAATACTGA
ATGGTGGAGCTTGGGATAATATAAGAACACAGACTCTGGA
GCATCTCAAGCTCAATTATGTGTCGTTGATAAAATAATGA
AGAAACTTTAGCTTTCTATAGCTGCTAAAACCGGTGGAAA
CTGAAGGAACGAAGGCTCAGAGGAAGCTGCAATAAACGGC
CACATCTACTGCCAGATTAGTCAAAGGTTTTGCTTTGAAA
TGGGACAGGCGTTAGCATCTGGATGTACTGTAGGTGAGTG
AGCAGAGTTTTTAATGTAGCTAATATTCAGTGAGGACTGA
ATAGAAATTTATTTGAAGGAATTCAGATCATTCTTTAAGA
TAATATATTTATAATTGAATTTTAATAAAGATCACTTTAT
TTTGTCTGTGATATTTTAACGGTTTGCTGCAGTTTTAAGG
TGTTTTACTTTTGTATGTGCAAGTTAATCTCTCTTTGTTT
AGCTGTCTTGTTTTGTGTTAAAGTGCTTTTAATTTTAGCT
GTTTTTTAATGTGCGGTAGTTTTTTTTAACACTATATATT
TTTAGACTTTTAATAATGGAAGATGTTCATTTATTTTTGT
ATTTTGGCCTAATGTTTGTCCTTATGAAGGATTCACGCAC
TTCATGATCACTTTTTTAGATGTGTTTTTTCTAGTGGTGT
CAAATGAAGTTAACTCATCCATATTGGATCTCTTGTGGCT
TTCTGAGCAAATGCAATTCTGAGAAGTGAAGAGACTCTGT
ATGTGCTTTGTGAAAGGTAAAGCAGGTTAGTCGCTGACGT
CTGTGTGAAAGGGTTTGCTGCTAAATAGTGATGCAGGTGT
TTGTTTTCCTGGAATCTACAGTAAGTGTTTTTCTGCCAAA
TGAAACAGGGCCTGAATCAGCATTAAATGCACACGTCTGC
TGTTTTTGCACAGAAAGCCACAATTCTTGACTGAAATGTG
TGTCTGTCTTCGTGTCAATGTGTAATTAAAATTTAATTTG
GCACTTA

rgl3a TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA rgl3a-002 (1) 320
rgl3a-003 (1) 740
mRNA rgl3a-202 3567
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rgl3a-202 Contained in:
OTHER rgl3a-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000054343 (1)
  • Ensembl_Trans:ENSDART00000151358 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC139712 (1) 2489bp
    GenBank:CK017197 (1) 866bp
    GenBank:DT875140 (1) 801bp
    GenBank:EB928906 (1) 754bp
    GenBank:BI533072 (1) 602bp
    GenBank:CD606353 (1) 500bp
    CITATIONS (2)