ZFIN ID: ZDB-TSCRIPT-120213-301
Transcript Name: slc44a2-003
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000054339 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000054339|OTTDARG00000037950|ZDB-GENE-030131-3065 slc44a2|no_translation slc44a2-003 LG_ CR394534.6 Danio rerio protein_coding KNOWN, 822 bp
CGAAGGGTGCCTATTATGGAAACCAAGGCGAGCCAAGGAA
ATTTGATCCCACATTTAAAGGCCCGATTTATAACAGGGGC
TGCACAGACATTCTCTGTTGTATCCTGTTTATCTTGGCCT
TGCTGGGATACTTTGCAGTTGGGATTTTGGCATGGTCTCA
AGGGGACCCTCGGAAAGTGATTTACCCGACGGAAAGCACC
GGTCAGTTTTGTGGGCAGGCCGGCACCCCACTTGAGAAAA
AGCCTCTGCTGTTCTACTTCAACATCATGAAGTGTGCAAG
TCCTCTGGTCCTGCTCGAGTTTCAGTGTCCCACCACTCAG
ATCTGTGTGGAGAAATGTCCGGATAAATTCATGACGTTAG
TGAATGCTTTAAAAAGCCAAAGCGACAAAACCTACTACAC
CCAGTTCTGCAAGGAGGGAGTAGACATGACCAAGAATGCT
CCTCAAATCCTGAGCGAGGGCTTGTGCCCTTCAATCCTCT
TCCCTAGCAAGAACTTCACACGGAGATGCTTGCCTGCTCT
AGAGACAATGAAAGGCGGTGTGGTTGTGATTGGGAACGAA
ACTCAATTCACTGTCGATCAAGGAGAAGTTATAAATGCAA
CAGACCTCCTTAATGCAGCAAAGAAATCCAATGTAGTAGT
TGAGGCTCGGGCAGTAGCCATGAGGATCTTTGAGGACTAC
ACACAGTCCTGGCACTGGATCCTTCTTGGTTTGGTGATCG
CTATGCTGATCAGTCTGATATTTATTCTCCTCCTGCGTTT
TCTGGCTGGAGTCATGGTCTGGGTTATGATCATCATGGTC
ATCATTGTTATCGGATACGGTA

slc44a2 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA slc44a2-003 822
mRNA slc44a2-201 (1) 2035
slc44a2-202 (1) 2785
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
slc44a2-003 Contained in:
OTHER slc44a2-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000054339 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CF266261 (1) 865bp
    CITATIONS (1)