ZFIN ID: ZDB-TSCRIPT-120213-1071
Transcript Name: slc44a2-202
Previous Name: slc44a2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000054338 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000054338|OTTDARG00000037950|ZDB-GENE-030131-3065 slc44a2|OTTDARP00000042687 slc44a2-001 LG_ CR394534.6 Danio rerio protein_coding KNOWN, 2785 bp
GGCGGATTCAACCCTGACACGCTCGAAAAAAACGAAACAC
ATCGTCATGTCTGTACTGTTACGTTCCTGCCATACACTTC
CACTGTAGAGCAGCGGAATTACTGATGGCCAGTTCCTCAC
AAGACTAAGCGACGGCAATACGATTCCCTCAGAGATTTAA
TTGACTGCCACAAGTGCGCATCATATCTTTGCAATGGAGC
CAGAGGAGAAAAACCCAGAATCTAAATATGGCGAGCCAAG
GAAATTTGATCCCACATTTAAAGGCCCGATTTATAACAGG
GGCTGCACAGACATTCTCTGTTGTATCCTGTTTATCTTGG
CCTTGCTGGGATACTTTGCAGTTGGGATTTTGGCATGGTC
TCAAGGGGACCCTCGGAAAGTGATTTACCCGACGGAAAGC
ACCGGTCAGTTTTGTGGGCAGGCCGGCACCCCACTTGAGA
AAAAGCCTCTGCTGTTCTACTTCAACATCATGAAGTGTGC
AAGTCCTCTGGTCCTGCTCGAGTTTCAGTGTCCCACCACT
CAGATCTGTGTGGAGAAATGTCCGGATAAATTCATGACGT
TAGTGAATGCTTTAAAAAGCCAAAGCGACAAAACCTACTA
CACCCAGTTCTGCAAGGAGGGAGTAGACATGACCAAGAAT
GCTCCTCAAATCCTGAGCGAGGGCTTGTGCCCTTCAATCC
TCTTCCCTAGCAAGAACTTCACACGGAGATGCTTGCCTGC
TCTAGAGACAATGAAAGGCGGTGTGGTTGTGATTGGGAAC
GAAACTCAATTCACTGTCGATCAAGGAGAAGTTATAAATG
CAACAGACCTCCTTAATGCAGCAAAGAAATCCAATGTAGT
AGTTGAGGCTCGGGCAGTAGCCATGAGGATCTTTGAGGAC
TACACACAGTCCTGGCACTGGATCCTTCTTGGTTTGGTGA
TCGCTATGCTGATCAGTCTGATATTTATTCTCCTCCTGCG
TTTTCTGGCTGGAGTCATGGTCTGGGTTATGATCATCATG
GTCATCATTGTTATCGGATACGGTATTTTCCATTGCTACA
TGCAGTACGCAAGCCTGAAAGGACAGGCTGGTTCTGATGT
CACTATCAAGGATCTGGGTCTGCAGACAGACTTCTCTGTG
TATTTACAGATTCAGCAGACTTGGCTTGCCTTCATGATAA
TCCTGTGTATTGTGGAAGCGGTGATCCTCCTCCTTCTAAT
CTTCCTCAGGAAGAGGCTCCTCATCGCTATTGCTCTCATC
AAAGAGGCCAGCAAGGCCATCGGTCATGTGATGTCATCGC
TGTTCTACCCACTGCTGACCTACGCCCTGATGTCATTGGT
CATCGCATACTGGGCCATCACCGCTGTGTTTTTGTCCACC
TCCAATGAGCCAATATACAAGGTTTTCAATACAAGCAATT
GTTCATATTCCAGGGCCACCTGTAATCCTGCGACTTTCAA
CACCTCAAACGTCACCACTGAATGTCCTGATGCCGAGTGT
CTGTTTGCGTTTTATGGAGGAGAGACGTTATACCACAAGT
GGCTGATTGTCTTCCAGTTCTACAATTTGTTCCTCTTCTT
CTGGTGCGTGAATTTTGTGATAGCGCTGGGTCAGGTCACA
CTGGCGGGGGCCTTTGCCTCTTATTACTGGGCGTTCAAAA
AGCCCGACGACATGCCTGCTTTCCCTATCTTCAACTCTTT
AGGACGAGCCCTCAGGTATCACACTGGCACTCTGGCGTTT
GGCTCCCTCATTCTTGCTATCGTTCAAGTCATCAGGGTCG
TACTGGAGTATCTGGATCAGAAGCTGAAAGGTGCCCAGAA
TAAATTTGCTAAATTCCTGCTGAGCTGCCTGAAGTGCTGC
TTCTGGTGTCTGGAGAAATTCATCAAGTTTATAAACAGGA
ACGCCTACATCATGGTGGCAATTTACGGCAAAAATTTCTG
CACATCTGCCAGGGATGCATTCTTCCTCCTAATGAGGAAC
ATAGTCCGTGTGGCAGTTCTCGACAAAGTGACTGACTTCC
TCTTATTTTTGGGCAAACTCCTAATCGTTGGTATTGTGGG
AATTTGTTCCTTCTTCTTTTTCACGGGCAAGATTAAGATA
GCGCAGGACGTTACGCCAGCTCTTAATTACTACTGGGTGC
CTATATTGACTGTGGTGTTTGGAGCCTATCTGATCGCTCA
TGGCTTTTTTAGCGTATATGCCATGTGCGTGGACACACTC
TTCCTCTGCTTCTTGGAGGATCTTGAACGCAACGATGGCA
CAGTGGACAGACCATACTTCATGCCAGAAAGACTGATGGC
CACCCTCAAGAAGTCAAATCAATCTCCTGGAGTCACCCGT
GTAGCTCCCAAGACGGCTAAAATTTAGGGGTTTGGGGGTG
AAACGAATTGAGTATATGAGGAGCCGAATAGTGGAGCAAA
CAAACAGAATTGTATAAAAAATAAGAGTGAGAGCTGACTT
GCACTGTTTTTATAGCCCAGGCACCCTCATGCTACGTCAT
TAGCCAAGTGTTAAACCTTTGTTCATTTTGTTCTTGCTAA
TTACTTTTTTGTGTATTTGGTGTTATAATATGTATATAAT
GTAGAAAAGACTATCTGACTGTATTAATGTTACTGAATTA
TTTTATTCTCCTGCTGACAGTGTTTCTGTTTGATACTGTG
GTATTTGCTCACAGTAATGACAACTTTTTTATGTATTTGA
TATGTTTTTGATGTTTCTGAAGTGTTATTACATCAAGGCT
GAAGCGAAGCCGTTATATTAAGTGTAAATAATTCAGTGAT
GTGAAATAAATATTAACCAGGCCAA

slc44a2 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA slc44a2-003 (1) 822
mRNA slc44a2-201 (1) 2035
slc44a2-202 2785
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
slc44a2-202 Contained in:
OTHER slc44a2-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000054338 (1)
  • Ensembl_Trans:ENSDART00000129674 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EE322813 (1) 942bp
    GenBank:EH596434 (1) 936bp
    GenBank:EE327613 (1) 855bp
    GenBank:EH579072 (1) 701bp
    GenBank:AI721856 (1) 586bp
    GenBank:EE690734 (1) 465bp
    GenBank:AL916021 (1) 436bp
    GenBank:EE209472 (1) 277bp
    CITATIONS (2)