Community Action Needed: Please respond to the NIH RFI
Transcript

nkain1-003

ID
ZDB-TSCRIPT-120213-264
Name
nkain1-003
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000054162 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000054162|OTTDARG00000026692|ZDB-GENE-040426-1472 nkain1|no_translation nkain1-003 LG_ CU207343.7 Danio rerio protein_coding KNOWN, 901 bp
TCTGGGTGGGCTGGAACTCGTTCATCATCTGTTTTTATCT
GGAAGTTGGTCACCTGTCTCAGGACAGGGATTTCCTGATG
ACATTTAACACTTCGCTTCATCGCTCCTGGTGGATGGAGA
ACGGGCCTGGTTGCCTAGTTACTCCAGTGCCTGATTCGCC
ATTGGCTCCTCAGGATCATCATGTGATCACTGTCAGCGGC
TGCTTGCTGGACTACCAGTACATAGAGGTGGTCAGTTCAG
CTCTGCAAGTGTTTCTCGCAGTGAGTCTTTTACCTTCAAT
CTATTGCTTCGGTCACATCTCAGTCTGAGGAACATTTTGC
ACCAGTAGCACCAATATTTCGTCATCTTAGAGTTATAATG
TTCTATCTGACATTTTTGTCAAAATCGAGTTATTGACATA
TTCTTATTAAATGATAACTTATTTACATTATGGGATTTTT
TTTGTAAGTTGTTTACATTTTAAGACCTTTTAAAAAATAA
ATGTTACACACATATTGTTTGCAATAGAATGCAAAAACTT
TGAAGCTCAGTATCTCAAAATCATTTAGATTGCCGATAGA
ACCTTGTAATTTCAAGGTGACGATATGTGTACAGGATATG
CTACAAGATTCGATCACTGTTAGAATGAAATGTACTCGCT
CTTATTTCATATGTCTGTTTCATAACTCGTAAAGAAGAAC
TTTTTGAGGAAATCATGAAGGGTGTTTCTCCTTAAAGGGG
ATTTCTCAGTGGTTTCACCTTCCAAACTGCTTCAAAGAGC
TTAAAAATAATCCCAGTTGAGGATTTTCTACCAAAGGCCA
ATCTCTACCAAAATACATTGGTTATTGTCTTAAATAAAAA
ATAAAAGATGTTTTAACCACAGAACAGAAGCTTGCATTAG
TGTCAGATGAGCCTTTTGCAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations