Community Action Needed: Please respond to the NIH RFI
Transcript

nkain1-201

ID
ZDB-TSCRIPT-090929-16156
Name
nkain1-201
Previous Names
  • nkain1-001
  • zgc:65908-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000035543 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000035543|OTTDARG00000026692|ZDB-GENE-040426-1472 nkain1|OTTDARP00000028560 nkain1-001 LG_ CU207343.7 Danio rerio protein_coding KNOWN, 1884 bp
CTGTGTATGTGTGTGTGTGTGTGAGTGAACGCCTCGTGTT
GTGGCGCGGGCGCGAGCGTCTCTATGCGGGTGCGCGCGCG
GGCTGCAGACTCGCACGCGGGTGTCTGATTTCCACCCACA
AACCCGCTCCGTGCACCCTCCCGGGGCCGATGTTGACAAA
GAGAAGGATGGTGGCTCAAGCTACACCGCCGGTTTAGTAA
TTCAGCTCATAAAAACCAACACCGGAGCTCACGGTGTGGC
AGATTGGCTAGGATTTGAGACCGCAGTTTGGACGCTTTGA
TTCGGACAATTCGGCGGAGGAGCTCCGGAATGACCAGCGG
ACATCCGCGAGCATCGACGCCGCGAAGCGTGCACTCGGCC
CGGCGGGCGTCTTGATGTTTTGACTGCTGATCGTGAAGCG
CGCTGGAGCTCACCGGGGACTCCGCTTTCTCCCGACGCCT
CGCGGGGCCCAAGCCGTGCCTCAAGCGCGAGAGCATGGGT
CGGTGCGACGGGAGGTGCACGCTGGTGGTCATCTGCTGCC
TGCAGCTGGTCGCTGCATTACAGAGGCAGGTGTTTGACTT
TATGGGATATCAGTGGGCTCCCATCCTGGCCAACTTCCTC
CATATCATGGCCGTCATTCTGGGAGTGTTTGGAACTGTGC
AAGTCCGCTCCAGATATCTGATACTGTATGCTGTGTGGCT
TGTGGTCTGGGTGGGCTGGAACTCGTTCATCATCTGTTTT
TATCTGGAAGTTGGTCACCTGTCTCAGGACAGGGATTTCC
TGATGACATTTAACACTTCGCTTCATCGCTCCTGGTGGAT
GGAGAACGGGCCTGGTTGCCTAGTTACTCCAGTGCCTGAT
TCGCCATTGGCTCCTCAGGATCATCATGTGATCACTGTCA
GCGGCTGCTTGCTGGACTACCAGTACATAGAGGTGGTCAG
TTCAGCTCTGCAAGTGTTTCTCGCACTCTTTGGATTTGTT
TATGCCTGCTATGTTAGTAAATACAGCCCGGATGACGAGG
ACAGCTTTGATTTCTTTGATGGATTGGGCTCGTATAATTA
CCAGCCTCCACAGAAGATCTCCCAATTACAGCTCCGGCCT
CTCTATACGACTGGATAGAAACCGGAAGAAATTCCAGGTC
CAGAAGAAAACACCTGCTAATTTCAGAGAGAGAGGAAGTC
CTCTTCATTACGGGAAACACTCAACCAGCTTCAGTGTCTG
TTTCCCGCAAACTTTTGTCTCCCTCTGTTGGAGAAAACAC
ACACACGCACCAGCCAGAGTTACAGAGAGACGACCAGCAA
CCAGACCGACACTACTTAACAGACTTCAAGACAGTCAAAA
CTGTGTGTGTGTGTGTGTGTGTGTTCGTTCACGTGCGCAC
AAGCACATAGGCCTTTGTATTTGTTTGAGTATTGACACGC
TGTGCGACCTTTGACCCAGGTAATCTTTGAACACAAATGC
CGGAGTTTCTGGCAGGAGAGCGGCTGTTTATACTCCGATA
TAAGACACTATAATGTACCGTGGTAGATGAATGTGTTAGG
TTGGCTTAGATGTGTATTTCGGGGGGAATGCTGTAGGACT
ATTTGTGCATGTAAATCTCACAATAGAGGAGTTGTGCCTC
TGGGTTGGCCCTCATACGTCTGCGTGAATGCATGAATGTG
CGTCGTGTCCGTGTATTTATGCACATAACGGGACTAGCCA
TATATGTTGATTGATTTGGACAGGAGATTAGAGTGAATGT
ATGGTAATGTACACTTCTTGTTTTGAGTGGCTGGAGGCGG
CGTAAGGGCAAACCCGAAGGGTGGGACGGCATAATAAACT
CTTTCTAGATTAATCTAATGTTTTGTTCACTTGTACATGA
GATTGGTGGTCACATTTTATTCACACTAAAAAAACAATGT
CTTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations