ZFIN ID: ZDB-TSCRIPT-120213-1083
Transcript Name: pa2g4a-201
Previous Name: ottdart00000054400

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000054400 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000054400|OTTDARG00000037994|ZDB-GENE-030616-161 pa2g4a|OTTDARP00000042731 pa2g4a-001 LG_ FP017252.5 Danio rerio protein_coding KNOWN, 2476 bp
ATATGACGACACCTCTGACGCGGCTGCGTAGTGGGCGTGG
TCACGCAATGCGTGGAGGTCGTGGGCGGAGCGGCACGTTC
GGTGAGCCGCCTGGTGGTAGCGTGACTGATTACTGCTGTC
CGTTCACCGTACAGACTCACAGAGAGCCTCTTCCAGAGCC
GGTGCAACGATGTCCGACGACGAGCAGCAAGAGCAGACCA
TCGCCGAGGACTTGGTCGTGACCAAGTACAAGATGGGCGG
TGACATTGCCAACCAGGCGTTGAGGGCGGTCATCGAGGCA
GCCAAACCAGGAGTATCAGTTCTCAGCCTCTGCCAGAAAG
GAGACGCTTTCATCATGGCAGAGACTGGGAAGATCTTTAA
ACGGGAAAAGGACATGAAGAAAGGTATTGCGTTCCCCACC
TGTGTGTCAGTCAATAACTGTGTCTGCCACTTCTCTCCCC
TGAAGAGCGACCCCGACTACATGCTGAAAGATGGAGATTT
GGTCAAAATTGATTTAGGAGTTCATGTTGACGGCTTCATC
TCTAATGTGGCCCATAGCTTTGTTATTGGAGCTACTAAGG
AAGCACCTGTGACAGGAAGGAAAGCTGACGTCATCAAAGC
AGCACACCTATGTGCAGAAGCAGCGCTGCGTCTTGTTAAA
CCAGGCAACCAGAACACTCAAGTAACCGAGGCCTGGAACA
AGATTGCCCACTCATTCAAGTGCAATCCAATTGAGGGTAT
GCTGTCCCATCAACTAAAGCAACATGTGATTGATGGAGAG
AAAACCATCATCCAGAATCCTACAGATCAACAAAAGAAGG
ACCATGAGAAGGCAGAGTTTGAGGTTCATGAAGTGTATGC
TGTAGATGTGCTGATCAGCTCAGGAGAGGGGAAGGCTAGA
GATGGAGGCCAGAGGACAACCATCTACAAAAGAGACCCCA
GCAAGCAGTATGGGCTGAAGATGAAGACCTCTAGAATGTT
CTTCAGTGAGGTGGAGAGACGCTTCGATGCCATGCCCTTC
ACTCTCAGGGCGTTTGAGGATGAAGGAAAAGCTCGTCTTG
GAGTGGTGGAGTGTGCCAAACACGAGCTCCTGCAGCCTTT
CAGTGTGCTCAATGAGAAAGAAGGTGAATTTGTGGCTCAG
TTTAAGTTTACAGTGCTACTGATGGCCAATGGGCCTTTGA
GAATCACCAGTGGACCACTTGAAGCAGAACTCTACAAGTC
TGAACATGACGTTCAAGATCCTGAACTGAAGTCTCTGATC
CAGAGTTCTGCAAGTCGTAAAGCACAGAAGAAGAAGAAAA
AGAAGGCCTCCAAAACTGCAGAGACTGCAACAGGCCAACC
AGCTGAGAATGAAGTTGCAGCCAAATAGAGGCAACTCAAG
CCTCTCAAGACCCCCACCCCCACCCCTGACGAGCAAAAAC
TCCCAACATTTCTCTCCGTTTTACCCTCATCACTCATTCG
ATCACGAGCCACTCTTAAACCTGTGTTAAACATGTCTGCC
TCCCCCCATTACGGAGAAACGCCACTCCACTACGAATTTG
TATTTTCATAATGAATCTATTTGCCATTTTGAAGCACTCG
ATTTGCATTTCAACTGGAACGCAAAGCCTTTTTCAAAATG
TTATTAAAAAAGCTGCGCAATTCTTTTGTAGAGTTGCGTT
TTTCACAACCGTTGACTGTTTGAAATGCTTTGTTTGGCCC
TAAGGTTAACTTAAAACCGCATTACGTTTGATTAGATTAA
GTGGTTCGAGGCCGATAATTCAATTGCAGCTATTTCTCAG
GGTTTCAAAGATGAAACAATCTTCTTTATCTGAGAAGTAG
GATCGAGAATAGCTTACAGGGGCATTAGAAATCAAATTGA
GTATATAGATTTCCTCATTACATTTGTACATCTGAAGACG
ACTCCTGAATACTGGAGAATTATTTGTTCATATCTTGTTA
ATCCCGTTCTTCATCTTTTAAAGTGTGGAATAATTTTGTT
GGTGCAGGGCTGTTTTTCCAAACAAATCTGACATATTATT
AATTCAACTTAGCATTAGAAAGTCTGATTTATCATGGGTT
TGCTTTAAAGGTCTGATCTAAAATACATCTGAACTCGCTG
AAGCTGAGTTATTACTTCCTCTGGACAAGGACCAACACGT
TATCACTTTACTTTTACTGAGCAATAGAGTGTCCGCTTGA
CTGAATATTCAGATCAAAACTAGGCTCGGACTGGATTGTA
AAGCTTTTCAGGCATTATTGTTCAATCCAGTCAGTGCAAC
AATTCCAGAAGAGGTGATGGGAAGTGGTTCTGTAATATTT
GACTTTTTCGCAGGTTTGGTTGAGGCTCAGTAGATCGTCC
GAAATGTTGGTTATTGTGACATGCTTACAGAGTGTAAAGG
TTTGTGTGGGAGAGGAGAGTGGAGGTTTGGAATCGACACG
ATCTTGTTTTTGTAGTACAAACCATCATATGGGACTATTT
TACAACTAATGAAATAAAACATAACTTTGAATATAA

pa2g4a TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA pa2g4a-001 (1) 2363
pa2g4a-201 2476
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pa2g4a-201 Contained in:
[BAC] CH73-354J22 (1)

Genome Resources: Vega_Trans:OTTDART00000054400 (1),  Ensembl_Trans:ENSDART00000057823 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC071407 (1) 1307 nt
GenBank:CO795416 (1) 887 nt
GenBank:EH514964 (1) 887 nt
CITATIONS (2)