Transcript

pa2g4a-201

ID
ZDB-TSCRIPT-120213-1083
Name
pa2g4a-201
Previous Names
  • ottdart00000054400
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000054400 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000054400|OTTDARG00000037994|ZDB-GENE-030616-161 pa2g4a|OTTDARP00000042731 pa2g4a-001 LG_ FP017252.5 Danio rerio protein_coding KNOWN, 2476 bp
ATATGACGACACCTCTGACGCGGCTGCGTAGTGGGCGTGG
TCACGCAATGCGTGGAGGTCGTGGGCGGAGCGGCACGTTC
GGTGAGCCGCCTGGTGGTAGCGTGACTGATTACTGCTGTC
CGTTCACCGTACAGACTCACAGAGAGCCTCTTCCAGAGCC
GGTGCAACGATGTCCGACGACGAGCAGCAAGAGCAGACCA
TCGCCGAGGACTTGGTCGTGACCAAGTACAAGATGGGCGG
TGACATTGCCAACCAGGCGTTGAGGGCGGTCATCGAGGCA
GCCAAACCAGGAGTATCAGTTCTCAGCCTCTGCCAGAAAG
GAGACGCTTTCATCATGGCAGAGACTGGGAAGATCTTTAA
ACGGGAAAAGGACATGAAGAAAGGTATTGCGTTCCCCACC
TGTGTGTCAGTCAATAACTGTGTCTGCCACTTCTCTCCCC
TGAAGAGCGACCCCGACTACATGCTGAAAGATGGAGATTT
GGTCAAAATTGATTTAGGAGTTCATGTTGACGGCTTCATC
TCTAATGTGGCCCATAGCTTTGTTATTGGAGCTACTAAGG
AAGCACCTGTGACAGGAAGGAAAGCTGACGTCATCAAAGC
AGCACACCTATGTGCAGAAGCAGCGCTGCGTCTTGTTAAA
CCAGGCAACCAGAACACTCAAGTAACCGAGGCCTGGAACA
AGATTGCCCACTCATTCAAGTGCAATCCAATTGAGGGTAT
GCTGTCCCATCAACTAAAGCAACATGTGATTGATGGAGAG
AAAACCATCATCCAGAATCCTACAGATCAACAAAAGAAGG
ACCATGAGAAGGCAGAGTTTGAGGTTCATGAAGTGTATGC
TGTAGATGTGCTGATCAGCTCAGGAGAGGGGAAGGCTAGA
GATGGAGGCCAGAGGACAACCATCTACAAAAGAGACCCCA
GCAAGCAGTATGGGCTGAAGATGAAGACCTCTAGAATGTT
CTTCAGTGAGGTGGAGAGACGCTTCGATGCCATGCCCTTC
ACTCTCAGGGCGTTTGAGGATGAAGGAAAAGCTCGTCTTG
GAGTGGTGGAGTGTGCCAAACACGAGCTCCTGCAGCCTTT
CAGTGTGCTCAATGAGAAAGAAGGTGAATTTGTGGCTCAG
TTTAAGTTTACAGTGCTACTGATGGCCAATGGGCCTTTGA
GAATCACCAGTGGACCACTTGAAGCAGAACTCTACAAGTC
TGAACATGACGTTCAAGATCCTGAACTGAAGTCTCTGATC
CAGAGTTCTGCAAGTCGTAAAGCACAGAAGAAGAAGAAAA
AGAAGGCCTCCAAAACTGCAGAGACTGCAACAGGCCAACC
AGCTGAGAATGAAGTTGCAGCCAAATAGAGGCAACTCAAG
CCTCTCAAGACCCCCACCCCCACCCCTGACGAGCAAAAAC
TCCCAACATTTCTCTCCGTTTTACCCTCATCACTCATTCG
ATCACGAGCCACTCTTAAACCTGTGTTAAACATGTCTGCC
TCCCCCCATTACGGAGAAACGCCACTCCACTACGAATTTG
TATTTTCATAATGAATCTATTTGCCATTTTGAAGCACTCG
ATTTGCATTTCAACTGGAACGCAAAGCCTTTTTCAAAATG
TTATTAAAAAAGCTGCGCAATTCTTTTGTAGAGTTGCGTT
TTTCACAACCGTTGACTGTTTGAAATGCTTTGTTTGGCCC
TAAGGTTAACTTAAAACCGCATTACGTTTGATTAGATTAA
GTGGTTCGAGGCCGATAATTCAATTGCAGCTATTTCTCAG
GGTTTCAAAGATGAAACAATCTTCTTTATCTGAGAAGTAG
GATCGAGAATAGCTTACAGGGGCATTAGAAATCAAATTGA
GTATATAGATTTCCTCATTACATTTGTACATCTGAAGACG
ACTCCTGAATACTGGAGAATTATTTGTTCATATCTTGTTA
ATCCCGTTCTTCATCTTTTAAAGTGTGGAATAATTTTGTT
GGTGCAGGGCTGTTTTTCCAAACAAATCTGACATATTATT
AATTCAACTTAGCATTAGAAAGTCTGATTTATCATGGGTT
TGCTTTAAAGGTCTGATCTAAAATACATCTGAACTCGCTG
AAGCTGAGTTATTACTTCCTCTGGACAAGGACCAACACGT
TATCACTTTACTTTTACTGAGCAATAGAGTGTCCGCTTGA
CTGAATATTCAGATCAAAACTAGGCTCGGACTGGATTGTA
AAGCTTTTCAGGCATTATTGTTCAATCCAGTCAGTGCAAC
AATTCCAGAAGAGGTGATGGGAAGTGGTTCTGTAATATTT
GACTTTTTCGCAGGTTTGGTTGAGGCTCAGTAGATCGTCC
GAAATGTTGGTTATTGTGACATGCTTACAGAGTGTAAAGG
TTTGTGTGGGAGAGGAGAGTGGAGGTTTGGAATCGACACG
ATCTTGTTTTTGTAGTACAAACCATCATATGGGACTATTT
TACAACTAATGAAATAAAACATAACTTTGAATATAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations