ZFIN ID: ZDB-TSCRIPT-090929-23218
Transcript Name: pa2g4a-001
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: AB
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000001856 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000001856|OTTDARG00000001738|ZDB-GENE-030616-161 pa2g4a|OTTDARP00000001641 BUSM1-150I12.2-001 LG_ AL591365.14 Danio rerio protein_coding NOVEL, 2363 bp
TGCTGTCCGTTCACCGTATAGACTCACAGAGAGCCTCTTC
CAGAGCCGGTGCAACGATGTCCGACGACGAGCAGCAAGAG
CAGACCATCGCCGAGGACTTGGTCGTGACCAAGTACAAGA
TGGGCGGTGACATTGCCAACCAGGCGTTGAGGGCGGTCAT
CGAGGCAGCCAAACCAGGAGTATCAGTTCTCAGCCTCTGC
CAGAAAGGAGACGCTTTCATCATGGCAGAGACTGGGAAGA
TCTTTAAACGGGAAAAGGACATGAAGAAAGGTATTGCGTT
CCCCACCTGTGTGTCAGTCAATAACTGTGTCTGCCACTTC
TCTCCCCTGAAGAGCGACCCCGACTACATGCTGAAAGATG
GAGATTTGGTCAAAATTGATTTAGGAGTTCATGTTGACGG
CTTCATCTCTAATGTGGCCCATAGCTTTGTTATTGGAGCT
ACTAAGGAAGCACCTGTGACAGGAAGGAAAGCTGACGTCA
TCAAAGCAGCACACCTATGTGCAGAAGCAGCGCTGCGTCT
TGTTAAACCAGGCAACCAGAACACTCAAGTAACCGAGGCC
TGGAACAAGATTGCCCACTCATTCAAGTGCAATCCAATTG
AGGGTATGCTGTCCCATCAACTAAAGCAACATGTGATTGA
TGGAGAGAAAACCATCATCCAGAATCCTACAGATCAACAA
AAGAAGGACCATGAGAAGGCAGAGTTTGAGGTTCATGAAG
TGTATGCTGTAGATGTGCTGATCAGCTCAGGAGAGGGGAA
GGCTAGAGATGGAGGCCAGAGGACAACCATCTACAAAAGA
GACCCCAGCAAGCAGTATGGGCTGAAGATGAAGACCTCTA
GAATGTTCTTCAGTGAGGTGGAGAGACGCTTCGATGCCAT
GCCCTTCACTCTCAGGGCGTTTGAGGATGAAGGAAAAGCT
CGTCTTGGAGTGGTGGAGTGTGCCAAACACGAGCTCCTGC
AGCCTTTCAGTGTGCTCAATGAGAAAGAAGGTGAATTTGT
GGCTCAGTTTAAGTTTACAGTGCTACTGATGGCCAATGGG
CCTTTGAGAATCACCAGTGGACCACTTGAAGCAGAACTCT
ACAAGTCTGAACATGACGTTCAAGATCCTGAACTGAAGTC
TCTGATCCAGAGTTCTGCAAGTCGTAAAGCACAGAAGAAG
AAGAAAAAGAAGGCCTCCAAAACTGCAGAGACTGCAACAG
GCCAACCAGCTGAGAATGAAGTTGCAGCCAAATAGAGGCA
ACTCAAGCCTCTCAAGACCCCCACCCCCACCCCTGACGAG
CAAAAACTCCCAACATTTCTCTCCGTTTTACCCTCATCAC
TCATTCGATCACGAGCCACTCTTAAACCTGTGTTAAACAT
GTCTGCCTCCCCCCATTACGGAGAAACGCCACTCCACTAC
GAATTTGTATTTTCATAATGAATCTATTTGCCATTTTGAA
GCACTCGATTTGCATTTCAACTGGAACGCAAAGCCTTTTT
CAAAATGTTATTAAAAAAGCTGCGCAATTCTTTTGTAGAG
TTGCGTTTTTCACAACCGTTGACTGTTTGAAATGCTTTGT
TTGGCCCTAAGGTTAACTTAAAACCGCATTACGTTTGATT
AGATTAAGTGGTTCGAGGCCGATAATTCAATTGCAGCTAT
TTCTCAGGGTTTCAAAGATGAAACAATCTTCTTTATCTGA
GAAGTAGGATCGAGAATAGCTTACAGGGGCATTAGAAATC
AAATTGAGTATATAGATTTCCTCATTACATTTGTACATCT
GAAGACGACTCCTGAATACTGGAGAATTATTTGTTCATAT
CTTGTTAATCCCGTTCTTCATCTTTTAAAGTGTGGAATAA
TTTTGTTGGTGCAGGGCTGTTTTTCCAAACAAATCTGACA
TATTATTAATTCAACTTAGCATTAGAAAGTCTGATTTATC
ATGGGTTTGCTTTAAAGGTCTGATCTAAAATACATCTGAA
CTCGCTGAAGCTGAGTTATTACTTCCTCTGGACAAGGACC
AACACGTTATCACTTTACTTTTACTGAGCAATAGAGTGTC
CGCTTGACTGAATATTCAGATCAAAACTAGGCTCGGACTG
GATTGTAAAGCTTTTCAGGCATTATTGTTCAATCCAGTCA
GTGCAACAATTCCAGAAGAGGTGATGGGAAGTGGTTCTGT
AATATTTGACTTTTTCGCAGGTTTGGTTGAGGCTCAGTAG
ATCGTCCGAAATGTTGGTTATTGTGACATGCTTACAGAGT
GTAAAGGTTTGTGTGGGAGAGGAGAGTGGAGGTTTGGAAT
CGACACGATCTTGTTTTTGTAGTACAAACCATCATATGGG
ACTATTTTACAACTAATGAAATAAAACATAACTTTGAATA
TAA

pa2g4a TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA pa2g4a-001 2363
pa2g4a-201 (1)    Ensembl 2476
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pa2g4a-001 Contained in:
[PAC] BUSM1-150I12 (1)

Genome Resources: Vega_Trans:OTTDART00000001856 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BQ285086 (1) 691 nt
GenBank:BQ263810 (1) 660 nt
GenBank:BM775923 (1) 650 nt
GenBank:BQ258512 (1) 644 nt
GenBank:AI658267 (1) 607 nt
GenBank:AL714617 (1) 592 nt
GenBank:AL714598 (1) 591 nt
GenBank:BI884960 (1) 586 nt
GenBank:BQ133406 (1) 569 nt
GenBank:AW595183 (1) 533 nt
GenBank:AI959368 (1) 527 nt
GenBank:AI477493 (1) 469 nt
GenBank:BQ131136 (1) 402 nt
CITATIONS (1)