Transcript

pa2g4a-001

ID
ZDB-TSCRIPT-090929-23218
Name
pa2g4a-001
Previous Names
None
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
AB
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000001856 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000001856|OTTDARG00000001738|ZDB-GENE-030616-161 pa2g4a|OTTDARP00000001641 BUSM1-150I12.2-001 LG_ AL591365.14 Danio rerio protein_coding NOVEL, 2363 bp
TGCTGTCCGTTCACCGTATAGACTCACAGAGAGCCTCTTC
CAGAGCCGGTGCAACGATGTCCGACGACGAGCAGCAAGAG
CAGACCATCGCCGAGGACTTGGTCGTGACCAAGTACAAGA
TGGGCGGTGACATTGCCAACCAGGCGTTGAGGGCGGTCAT
CGAGGCAGCCAAACCAGGAGTATCAGTTCTCAGCCTCTGC
CAGAAAGGAGACGCTTTCATCATGGCAGAGACTGGGAAGA
TCTTTAAACGGGAAAAGGACATGAAGAAAGGTATTGCGTT
CCCCACCTGTGTGTCAGTCAATAACTGTGTCTGCCACTTC
TCTCCCCTGAAGAGCGACCCCGACTACATGCTGAAAGATG
GAGATTTGGTCAAAATTGATTTAGGAGTTCATGTTGACGG
CTTCATCTCTAATGTGGCCCATAGCTTTGTTATTGGAGCT
ACTAAGGAAGCACCTGTGACAGGAAGGAAAGCTGACGTCA
TCAAAGCAGCACACCTATGTGCAGAAGCAGCGCTGCGTCT
TGTTAAACCAGGCAACCAGAACACTCAAGTAACCGAGGCC
TGGAACAAGATTGCCCACTCATTCAAGTGCAATCCAATTG
AGGGTATGCTGTCCCATCAACTAAAGCAACATGTGATTGA
TGGAGAGAAAACCATCATCCAGAATCCTACAGATCAACAA
AAGAAGGACCATGAGAAGGCAGAGTTTGAGGTTCATGAAG
TGTATGCTGTAGATGTGCTGATCAGCTCAGGAGAGGGGAA
GGCTAGAGATGGAGGCCAGAGGACAACCATCTACAAAAGA
GACCCCAGCAAGCAGTATGGGCTGAAGATGAAGACCTCTA
GAATGTTCTTCAGTGAGGTGGAGAGACGCTTCGATGCCAT
GCCCTTCACTCTCAGGGCGTTTGAGGATGAAGGAAAAGCT
CGTCTTGGAGTGGTGGAGTGTGCCAAACACGAGCTCCTGC
AGCCTTTCAGTGTGCTCAATGAGAAAGAAGGTGAATTTGT
GGCTCAGTTTAAGTTTACAGTGCTACTGATGGCCAATGGG
CCTTTGAGAATCACCAGTGGACCACTTGAAGCAGAACTCT
ACAAGTCTGAACATGACGTTCAAGATCCTGAACTGAAGTC
TCTGATCCAGAGTTCTGCAAGTCGTAAAGCACAGAAGAAG
AAGAAAAAGAAGGCCTCCAAAACTGCAGAGACTGCAACAG
GCCAACCAGCTGAGAATGAAGTTGCAGCCAAATAGAGGCA
ACTCAAGCCTCTCAAGACCCCCACCCCCACCCCTGACGAG
CAAAAACTCCCAACATTTCTCTCCGTTTTACCCTCATCAC
TCATTCGATCACGAGCCACTCTTAAACCTGTGTTAAACAT
GTCTGCCTCCCCCCATTACGGAGAAACGCCACTCCACTAC
GAATTTGTATTTTCATAATGAATCTATTTGCCATTTTGAA
GCACTCGATTTGCATTTCAACTGGAACGCAAAGCCTTTTT
CAAAATGTTATTAAAAAAGCTGCGCAATTCTTTTGTAGAG
TTGCGTTTTTCACAACCGTTGACTGTTTGAAATGCTTTGT
TTGGCCCTAAGGTTAACTTAAAACCGCATTACGTTTGATT
AGATTAAGTGGTTCGAGGCCGATAATTCAATTGCAGCTAT
TTCTCAGGGTTTCAAAGATGAAACAATCTTCTTTATCTGA
GAAGTAGGATCGAGAATAGCTTACAGGGGCATTAGAAATC
AAATTGAGTATATAGATTTCCTCATTACATTTGTACATCT
GAAGACGACTCCTGAATACTGGAGAATTATTTGTTCATAT
CTTGTTAATCCCGTTCTTCATCTTTTAAAGTGTGGAATAA
TTTTGTTGGTGCAGGGCTGTTTTTCCAAACAAATCTGACA
TATTATTAATTCAACTTAGCATTAGAAAGTCTGATTTATC
ATGGGTTTGCTTTAAAGGTCTGATCTAAAATACATCTGAA
CTCGCTGAAGCTGAGTTATTACTTCCTCTGGACAAGGACC
AACACGTTATCACTTTACTTTTACTGAGCAATAGAGTGTC
CGCTTGACTGAATATTCAGATCAAAACTAGGCTCGGACTG
GATTGTAAAGCTTTTCAGGCATTATTGTTCAATCCAGTCA
GTGCAACAATTCCAGAAGAGGTGATGGGAAGTGGTTCTGT
AATATTTGACTTTTTCGCAGGTTTGGTTGAGGCTCAGTAG
ATCGTCCGAAATGTTGGTTATTGTGACATGCTTACAGAGT
GTAAAGGTTTGTGTGGGAGAGGAGAGTGGAGGTTTGGAAT
CGACACGATCTTGTTTTTGTAGTACAAACCATCATATGGG
ACTATTTTACAACTAATGAAATAAAACATAACTTTGAATA
TAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations