Transcript

abcc4-201

ID
ZDB-TSCRIPT-120213-1082
Name
abcc4-201
Previous Names
  • ottdart00000054397
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000054397 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000054397|OTTDARG00000037991|ZDB-GENE-030616-511 abcc4|OTTDARP00000042729 abcc4-001 LG_none BX663606.4,AL953886.9 Danio rerio protein_coding KNOWN, 4305 bp
GACATGTGCGTGTTAGAAAGTTATACAACAGTTTACAAGG
TAAATGTCTTGCGCTGGTTACAGGTTATGCGAGGGGTACC
AGAGTCCGGCTGAACCGCGGGGAGGATGACAAGCGATATG
GAGCCGATAAAGAAAGATGCCAAAAGCAACCCCTCAGCCT
CGGCTAATCTCTTCTCGCAGATATTTTTCTGCTGGCTGAA
TCCTCTTTTCAGTATCGGATCTAAGAGGAGACTTGAGGAG
GATGACATGTTTAATGTGCTTCCGGAGGATCGGTCAAAGA
AACTCGGGGAGGAGCTGCAGAGCTACTGGGACCAAGAGAA
GGAGAAAGCAGCCAAAGAACTCAAGACCCCAAAACTCACG
AAAGCCATTATCAGGTGCTACTGGAAATCTTATGCAGTTC
TGGGAGTGTTTACTCTTATTGAGGAGTCAATAAAAGTGAT
CCAGCCTGTGTTTTTGGGCAAACTCATTAAGTATTTTGAG
AACTATCGGCACGATGACATGGCAGCTTTATCTGAAGCTT
ATGGATATGCAACAGGCGTCTGTCTCTCCACCCTGGGCTT
GGCTTTGCTCCATCATCTCTATTTCTACCACGTTCAAAGA
GCTGGAATGAAAATTCGCATTGCAATGTGTCACATGATCT
ACAGGAAGGCTCTATGTCTTAGCGCTGCAGCAATGGGCCA
AACAACCACAGGGCAGATCGTTAATCTTTTGTCCAATGAC
GTCAACAAATTCGATGAGTTGACTATTTTTCTGCACTTCC
TGTGGGTGGGGCCTCTGCAAGCCGCAGCTGTGATTGGTCT
GCTTTGGCAAGAGATCGGACCATCGTGCCTTGCTGGGATG
GCAGTTTTAGTCTTTCTAATGCCGCTTCAGACCATGTTCG
GGAAACTGTTTTCCAAGTACAGGAGTAAAACCGCAGCCTT
GACTGACAGCCGGATACGCACTATGAATGAGGTGGTTTCT
GGCATACGTATAATTAAGATGTATGCCTGGGAGAAGCCGT
TCGCCATGCTGGTTAATGATGTACGAAGGAAGGAGATCTC
CAAAATCATGAGCAGCTCTTACCTGCGTGGCTTGAACATG
GCCTCGTTCTTTACAGCCAATAAAATCATCCTGTTTGTGA
CGTTCACCGTGTACGTGTTGGTGGGAAACACCATGTCTGC
GAGTCGCGTGTTTGTGGCCGTGTCTCTGTACAGCGCCGTC
CGCCTCACCGTCACTCTGTTCTTCCCTGCTGCCATCGAGA
AAGTGTCTGAATCCGCCATCAGCATCCGCAGGATCAAGAA
GTTCCTGTTGCTGGATGAGCTTGTGAAAAATCACCTTCCG
CTTTCTCAGGAGGAGAAGAAAGAGCCGTCGGTGGAGATGC
AGGATCTCATATGCTACTGGGACAAGACTCTGGATGCTCC
AACATTACAAAATGTGTGTTTTACTGTGAAGCCGGGTCAG
CTGCTGGCTGTAATTGGTCCTGTGGGAGCTGGAAAGTCGT
CTCTCCTCAGCACCGTTCTGGGAGAGCTTCCGGCTGAGAA
GGGTGTGATAAAGGTGAAAGGAGAGCTGACCTACGCCTCC
CAGCAGCCCTGGGTCTTTCCAGGCACCATTCGCAGCAACA
TACTGTTTGGAAAAGAGCTGCAGCCACAGCGATATGAGCG
AGTCCTCCGAGCCTGTGCGCTTAAGAGGGACATGGAGCTG
CTTCCTGATGGGGATTTGACAGTGATTGGAGACCGGGGAG
CAACTCTCAGTGGAGGACAGAAAGCCAGAGTCAACCTGGC
CAGGGCTGTGTATCAGGATGCTGATATTTACCTGCTGGAT
GATCCATTGAGTGCTGTGGATGCTGAAGTGAGCAGACATC
TGTTTGAACAGTGTGTTTGTGGTATTCTGAAGGACAAGCC
CAGGATCTTGGTGACCCATCAACTGCAGTACCTGAAGGCT
GCGAATCAGATCCTGGTTTTGAAAGAGGGGCACATGGTGG
CTCGAGGCTCGTACTCTGAGCTTCAGCAGTCCGGACTGGA
TTTCACCTCTCTTCTGAAGAAGGACGAAGAAGAGGAGAGC
GGCAGTGAAAAAGGAGAAGCTCCTCGATCTCCACGCAGTC
GCACCGTTTCCCAGAACTCCGTCCGTTCACATTCTTCCTC
CGTTTTGTCGGTGAAAGACGACTCTGATCAGCTCCCGGCT
GAACCTGTGCACACTATGGCCGAGGAGTTGCGCTCAGAGG
GAAACATCGGCATCCGCATGTATTGGAAGTATTTTCGAGC
CGGAGCAAACGTGGTGATGCTGGTTTTACTCTTGCTGCTC
AATCTGCTGGCGCAGACTTTTTATATTCTTCAGGACTGGT
GGCTTTCGTACTGGGCCACAGAGCAGGAGAAACTGGACCA
CAATACCAACAATACCAATACCAACAATACCAGTGCTGGA
AACACGACTCAGCAACTTGACCTGAACTTCTATTTGGGCA
TCTATGCAGGTTTAACAGGAGCCACGATTGTCTTCGGCTT
CATGCGTTGTCTAATTATGTTCAATGCTCTGGTGAGCTCA
GCAGAGATGCTTCACAACCGCATGTTCAACAGCATCTTGA
GGACACCAGTGCGCTTTTTCGACATCAATCCCATTGGAAG
AATCCTCAACCGCTTCTCCAAGGACATCGGCCACCTTGAC
TCCTTACTTCCGTGGACATTTGTGGATTTCATCCAGGTGT
TTCTGCAAATTGTCGGCGTGATTGCTGTTGCATCTTCTGT
CATCCCTTGGATTCTGATCCCTGTTCTTCCCCTGTTGATT
TGCTTCCTGTTCCTGCGCCGCTACTTCCTGCGGACATCTC
GAGACGTCAAGCGCATCGAATCCACCACTCGAAGTCCTGT
TTTCTCCCATCTGTCCTCCTCACTGCAAGGCCTGTGGACC
ATTCGTGCTTTTAAAGCGGAGGAAAGGTTTCAGCAAACAT
TTGATGCTCACCAGGATCTGCATTCAGAGGCCTGGTTCCT
GTTCTTGACCACTTCACGCTGGTTTGCGGTGCGTTTGGAT
GGGATGTGCTCTGTGTTTGTGACTATCACAGCATTCGGAT
GTCTTCTTCTTAAAGACACTATGAATGCAGGAGATGTGGG
CCTGGCATTGTCCTATGCTGTCACCCTGATGGGGATGTTC
CAGTGGGGTGTAAGACAGAGTGCTGAGGTGGAGAACATGA
TGACGTCAGTGGAGAGAGTAGTAGAGTACACAGAGCTGGA
AAGTGAAGCACCTTGGGAAACTCAAAAACGCCCCTCTCCC
GACTGGCCAAATCGTGGCCTGATAACCTTCGACAGGGTCA
ACTTCTCCTACAGTTCTGACGGACCAGTTGTTCTCAAGAA
CATCTCAGCCATGTTCAGACCCAGAGAGAAGGTTGGAATA
GTTGGACGGACTGGTGCAGGGAAAAGCTCCCTGATTTCAG
CTTTGTTTCGTCTGTCAGAGCCAGAAGGAAAAATCCTGGT
TGACGGAGTGTTGACCTCAGAGATCGGCCTCCACGACCTC
CGTCAGAAGATGTCCATCATCCCGCAGGATCCTGTCCTGT
TCACAGGAACCATGAGGAAGAACCTGGACCCCTTCAACCA
GCACTCGGACCATGACTTGTGGAAAGCTCTGGAAGAGGTT
CAGCTGAAGGCGGCTGTGGAGGAACTGCCTGGAAAATTGG
AGACCGAACTGGCTGAGTCTGGATCAAACTTCAGCGTGGG
TCAACGGCAGCTCGTCTGTCTGGCCAGAGCCATCCTGAGG
AAGAATCGCGTTCTCATCATCGATGAAGCCACCGCAAATG
TGGACCCTCGGACAGATGAGCTGATCCAGAAAACCATCCG
TGATAAGTTTAAGGAATGCACAGTCCTCACCATCGCACAC
AGACTCAACACCATCATAGACAGCGACCGCATCCTGGTTC
TAGATGCCGGTCGGATCCACGAATATGACGCTCCACACGT
TCTACTACAGAACCAGAGCGGGATATTTTATAAGATGGTG
CAGCAGACGGGAAAAGCAGAAGCGACGTCTCTGCTACAGA
CGGCCAAACAGGCATACGCAAACCGCAGTCCGGCCCACCA
GCTCAATGGTTTTGCCACCACAGGAGATGGCAGTTTGATT
ATATTCGAGACTGCTTTATAATAGCCTGGAAGTGCCTGAT
GTAAACGGGGCACAGCTTCCCCAGAATCCTCCTCCTGCGC
AGGACAACAGGCACAATTTCTTCACCAAAGAAAACCCGGC
TGACAGAGCCAAAGACACGTGCATGAACGATCACGCCAGA
GAGGACAGAGCTGCAGGGAGACTTCAACACCAGCATTTCT
CCAGTTCAGTGGAGATTGTACACCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations