header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-120213-1041
Transcript Name: nfyc-201
Previous Name: nfyc-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000054199 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000054199|OTTDARG00000015635|ZDB-GENE-030131-2165 nfyc|OTTDARP00000042581 nfyc-002 LG_none BX957244.15,CR388024.3 Danio rerio protein_coding KNOWN, 389 bp
AGTTGACAAATCATCGGCCATCTTGGTTGCTGTAACAGCC
TGAAATAAATTAATTATTACGGCGAACCGGACTACACTAC
GATTTCATCGCGTAAAATCTGGAGATGTCGGCAGACTCAT
TTGGAGCGGGTGGCAGCGATGCCCAGCAGAGCTTACAGTC
TTTTTGGCCCAGGGTGATGGAAGAGATCAGGAATCTTACT
GTGAAGGATTTCCGTGTGCAAGAGCTTCCTCTCGCTCGCA
TCAAGAAAATTATGAAACTGGATGAGGATGTGAAGATGAT
CAGTGCCGAGGCGCCGGTGCTGTTTGCCAAAGCGGCACAG
ATCTTCATCACAGAGCTCACTCTCAGAGCCTGGATCCACA
CCGAGGACAACAAACGCCGCACACTACAG

nfyc TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA nfyc-001 (1) 477
nfyc-201 389
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
nfyc-201 Contained in:
OTHER nfyc-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000054199 (1)
  • Ensembl_Trans:ENSDART00000151605 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC045364 (1) 2190bp
    GenBank:BC065645 (1) 2140bp
    GenBank:CN015040 (1) 945bp
    GenBank:CK147010 (1) 825bp
    GenBank:BM035706 (1) 576bp
    CITATIONS (2)