ZFIN ID: ZDB-TSCRIPT-120213-1019
Transcript Name: krit1-003
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000054013 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000054013|OTTDARG00000025954|ZDB-GENE-030131-555 krit1|no_translation krit1-003 LG_ CR855331.14 Danio rerio protein_coding KNOWN, 804 bp
GTCTGCAGCTGAAGCCGTACCACAAGCCCTTGCAGCACTT
ACGGATGTGGAGCGAGATCGTGACGGATCTCACTGCTCTG
GATCCACAGAGAGAAAGTCCACAGCTCTTCCTGCGCAGAG
ACGTTCGGCTGCCTTTAGAGGTCGAGAAAAAGGTTGAAGA
TCCGCTGTCCATCCTCATCCTATTTGATGAAGCTCGTCAC
TGCCTCCTTAAAGGTTTCCTCTCGACGTCAGATAACAAGC
TAATCACGCTCGCAAGCCTCCTCCTGCAGATCATCTACGG
AAACTACGACAGCAAGAAGCACAAACAGGGCTTTCTAAAT
GAGGAAAACCTGAAATCCATAGTTCCCATTTCAAAGGTCA
AGAGCAAAGCACATCACTGGACTAACAGGATACTTCACGA
GTACAAGAGTCTGAGCACTAGTGAGGGTGTGAGTAAAGAA
ATGCATCACCTCCAGAGGCTCTTCCTGCAGAACTGCTGGG
ATATTCCTACTTATGGTGCAGCGTTTTTCACAGGACAGGT
CTTCACTAAAGCCAGCTCCAGCACACACAAGGTGATCCGC
GTGTATGTGGGCGTCAACACCAAAGGCCTGCATCTGATGA
ACATGGAGACAAAAGTGAGACTTCAACCACTCATGGATGC
TTTCACAAAACGGGAAAAATCTAGAGGAGCATAGCAAAAA
TACAGTGTAGTTGAAATTATGTAGTTTGACATTTTTTGCA
ATAACTTTACTTGAGTGACCAAACTGTTTTATTTAAATGA
ACCAACATTTTTCCCTCTATATTCACTGAGAAATTGATTA
AAAA

krit1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA krit1-201 (1)    Ensembl 2881
ncRNA krit1-003 804
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
krit1-003 Contained in:
[BAC] CH211-153F2 (1)

Genome Resources: Vega_Trans:OTTDART00000054013 (1),  Ensembl_Trans:ENSDART00000162723 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CK706629 (1) 822 bp
CITATIONS (2)