ZFIN ID: ZDB-TSCRIPT-110912-774
Transcript Name: ntrk2b-201
Previous Name: ottdart00000051880

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000051880 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000051880|OTTDARG00000036440|ZDB-GENE-010126-2 ntrk2b|OTTDARP00000040765 ntrk2b-001 LG_none CU468920.7,BX323563.11 Danio rerio protein_coding KNOWN, 2616 bp
CGCGGTATCACCTTTTCGCGGAGACCAGATAAGGCCACTC
CATGACAGTCTGGCGTCGCGCACAACGTCTTTGCGCATCC
CACAGCAGCGGCGTCTCATCTCGGAATTGCTGAAAATACT
ACAAGACACTACACAACGCCGAACGCACCGCGCTAGACCT
GCTATGACCGCAGGGGTTCGTGGAATGGCTTGCTGGGGGT
TGTGTGGGTTTTTATTCGGGCTGCTGAGGATCAGCTCGGC
TTGTCCTGTGTCGTGCTTTTGCAATGCCTCAAGGATCTCG
TGTATCGATCAAGAACCAGGGATCGAGGATTTCCCTGTCT
TGATGCCGGAGTCTGACATGGAGAACATCACGGATATATA
TATATCAAATCAAAAAAGGCTATTTACAATCAACGAGGAC
CACATGAAGTTCTACTCGAATCTCAGGAATTTAACAGTGA
CCAATACCCACCTGACATATGTATCTACCATGGCCTTTTT
CAACAATTCCAAGCTTCAATATCTGAATCTCGGAGACAAT
AACTTATCAACACTCTCTTGGATGGCAATGCGGAATTCAA
ACGTATCAACTTTGTTGCTCTCTGGGAACCCTTTGCAATG
TGCATGTGAGAACATCTGGATCAAACTCTGGTTGGATGAC
AGTGAAAGAGACGTTCTGCAGTGTCTACAGGAAGGAGGAA
AAGCAAAAACCCTGTCTAGACTCACTCTGCCTTTATGTGA
GCATCCACGTGTCGAGGTATTCCCCACTGACGTTAGTCAA
ATGGCAGGAAGTGATGCTACAGTGATATGTAACGCATCAG
GTTCCCCGACCCCAGAGCTCACTTGGACCTTAAATTCCAG
CGAACACCCTCCTCTCTCAACCAGCCACGAGATCAGCAAA
ATGGACCTGCAGTCGGTGCTGACTCTAAATGGACTTTCGC
CTAATGACAATGGCAGAAAGCTCATTTGTAGTGCTGAAAA
CATCGTGGGCCAGATCGAGGCTACAGTCATGCTCAATATT
TCTTTTCCCCCTACTGTCTTGGAGCTGTACCTGCCCGAGA
GGAGCCAGGACTGGTGCATCCCTTTCGTTGTGACGGGCAA
CCCGAGACCTGACCTCCACTGGTACCATGAGGGAAAGCCG
CTAGAGGAGCAGGAGTACATCAGAACTGAAATCCACGATA
TCACCAATACCGAGTACCACGGCTGTCTGAAGCTGGACAC
CCCCACTCACATCCATAATGGCATTTACACGCTGGTGGCC
AGCAATGAGTTCGGAGAGGACAGAGGGAACGTGACGGCAC
ACTTCATGCGCATACCTGACGTGGATCATTCAGGGATAGA
GGGAGTGTTCTATTATGACACAACTGTTAGTCCGGATATC
CCACCACTGGAGGACAGAGTTGCGGTTTACATAGTAGTGG
GAATAGCTGGGGTTGCTTTAACTGGATGCATCCTGATGTT
AGTTTTCCTCAAGTATGGCAGAAGCTCCAAATTTGGAATG
AAAGGCTCCTCGTCTGTCATTAGTAATGATGATGACTCTG
CCAGCCCGCTCCACCACGTTTCCAACGGCAACAACACGCC
ATCATCCTCGGAGATGGGTCCTGATGCAGTTATTATTGGA
ATGACAAAGATTCCAGTCATTGAGAACCCTCAGTACTTCC
GCAACCCTGGCAGCATGCTGAAATCGGACACTCTTGTCCA
ACATATAAAGCGTCACAACATTTTACTGAAGAGGGAGCTG
GGAGAGGGGGCTTTCGGGAAAGTGTTCTTAGCTGAATGCT
ACAACTTGTCTCCTGACCAAGAGAAGATTTTGGTGGCTGT
TAAGACTTTGAAAGAAGCCAGTGAAAGTGGGCGAGCAGAT
TTCCACAGAGAGGCAGAACTCCTGACCAACCTGCAGCATG
AGCACATTGTCAAATTTTACGGCGTGTGTGTAGAAAGTGA
CCCCCTCATTATGGTGTTTGAGTACATGAAACACGGAGAT
CTCAACAAGTTTCTCAGGGCTCATGGTCCAGATGCGGTGC
TAATGGCAGACGGACAGCAGAGTTTGCTGGTGGAGTTGAC
TCAGCCTCAGATGCTGCACATTGCTCAGCAGATAGCAGCA
GGAATGGTGTATCTGGCTTCACAGCATTTTGTGCACAGAG
ACCTGGCCACACGCAACTGCCTGGTGGGGGAAAACCTGCT
TGTAAAGATAGGAGACTTTGGCATGTCCAGAGATGTGTAC
AGCACCGACTACTATAGGGTAAGTGTGGGTGGTCACACCA
TGCTGCCCATCCGATGGATGCCCCCAGAGAGCATTATGTA
CAGAAGATTCACCACAGAGAGTGACGTGTGGAGTTTGGGT
GTAGTACTCTGGGAAATCTTCACCTATGGCAAGCAACCCT
GGTATCAGCTCTCAAACAATGAGGTGATCGAGTGTATCAC
ACAGGGTCGGGTGTTACAGAGACCTCGTACTTGCCCCAAA
GAAGTGTATGATCTGATGCTGGGCTGCTGGCAGAGGGAGC
CATACATGAGACTCAACATCAAAGAAATCCACAATCTGCT
CCAGAGCCTGGCCAAGGCCTCGCCTGTGTACCTGGACATC
CTGGGCTAATCCTTTTGCCAGTATGGGCGTGAAATTATTA
GTAAGAAAGAGTGTCT

ntrk2b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA ntrk2b-201 2616
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ntrk2b-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000051880 (1),  Ensembl_Trans:ENSDART00000161412 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CU468742 (1) 1203 nt
GenBank:AI959473 (1) 592 nt
GenBank:EB777985 (1) 325 nt
CITATIONS (2)