ZFIN ID: ZDB-TSCRIPT-110912-613
Transcript Name: bcap29-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000051188 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000051188|OTTDARG00000007454|ZDB-GENE-050522-468 bcap29|no_translation bcap29-002 LG_ BX072538.10 Danio rerio protein_coding KNOWN, 440 bp
GAGGAGAGCAAACGGCTGAAGGAGGAGCTGCAGAGACTGA
AGGAGGAGCTGAAGACCAGCGCAGATGCTCTGAAAAAGTC
AAAGTCTGATTTAGACACCATGAAGAAACAAAGTGACGGA
CTGACCAAAGAGTACGAGCGGCTGCTTCAGGAGCACCAGC
AGCTGCAGGTCAAACACTAACAACACACACCTTTTACAGT
ACTTCACATCAAATTAACATTATTGAACAGTAATTCAGTT
CTGTCATATAAATAACAACAAGCTAGATTAAATAAGTTAG
AAATAAGAAGACATTTAAATAAGAAATGAACAGAGAATGG
AGTACTTATTACCAAAGTTGCTATGCATGTAGACAGTGCT
GCTGAAGTCTCACAAACTAATTTGATAGGAGCACATGATA
TGATGGATCGCGGCTGGTCTCTCATCTGTAATCATTAGTA

bcap29 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA bcap29-201 (1)    Ensembl 1516
ncRNA bcap29-002 440
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
bcap29-002 Contained in:

Genome Resources: Vega_Trans:OTTDART00000051188 (1),  Ensembl_Trans:ENSDART00000150654 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EE202361 (1) 446 nt
CITATIONS (2)