ZFIN ID: ZDB-TSCRIPT-090929-1192
Transcript Name: bcap29-201
Previous Names: bcap29-001, zgc:110731-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000008406 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000008406|OTTDARG00000007454|ZDB-GENE-050522-468 bcap29|OTTDARP00000007313 bcap29-001 LG_ BX072538.10 Danio rerio protein_coding KNOWN, 1516 bp
GCGCGTGTAAGTGACGTCACTGGAGTGAGACGGGACGGCA
GTTGCGCGTTTGTCAGACTTTAGTGTAGTTTTCCAGAATT
GTGTCTTTCGTCTGAAATTTGTCAGGAGATTTTGTTTAAA
TCTGAAATAAAATGACGCTGCAGTGGACGGCGGTTGCAAC
TTTCCTGTATGTAGAGATTGCCGTTCTTATCTTCTTTTGT
CTGCCGTTCATTTCTGCTAAAAGATGGCAGAAGATTTTCA
AGTGGAGCATCTGGAGCCGGCTTTCCCAGTTCTGGAACAA
GGGCTTCCTCGCCATGATAATAATCCTCATCGTTCTCTTT
CTTGATGCTCTCCGTGAGGTCAGAAAATACTCGAACTCGG
ATCAGTCCAAAGATGCCAAGCTGCACCCCAACATGTTCGA
CCACATGCACATGAAGCTCTTCCGGGCTCAGAGGAACCTC
TACATCTCCGGCTTCTCGCTCTTCCTCTGGCTGGTGATGA
GGAGGGTGGTCACTCTGATCAGTCAGCTGGCCACAGCTGC
AGATTCTTGCGTAGATCTACAGAACCAGGTCGAAACTACC
AATAAAGCTGCCAAGAAGTACATGGAGGACAACCAGATCC
TCAAACAGGCTCTTGCAGATGCCAAAGAAGGAGGACAAAA
AGCAGATCCAGAGGAGAGCAAACGGCTGAAGGAGGAGCTG
CAGAGACTGAAGGAGGAGCTGAAGACCAGCGCAGATGCTC
TGAAAAAGTCAAAGTCTGATTTAGACACCATGAAGAAACA
AAGTGACGGACTGACCAAAGAGTACGAGCGGCTGCTTCAG
GAGCACCAGCAGCTGCAGAATCAGATGGACAGCGGAGATA
AAAAAGAAAACTAGAGGAACGGACACACCACACAATGTAA
ATCTGCACGATAATCATCATTACGCTCAGTTCATCCTCAA
CACACTCACCTGACACTCCTGATGATGACTTCCTGTCAGG
TCACATGATCAGAGCGGTTTCACAGTTTTCTAGCATCGTT
GTTTAATAAAATGTGCAAAACTTCGTCATTTAGCTCGTCA
CTGGAGCGAACCTGTTAAAATGACAACTGTATACCTTATT
TAAGTCTTTTTTAATAGTAATGTTTCCCCTAATATGGACA
GTAATGGGTATAGAGTTGTTATTTTAAAGAAACTCTTCAC
CTTTTTGTGTAATTAGGCTCATTTTACAGCTCTTCTAGAG
TTAATCAGGTGAATTTTACTATTTTTTTGTAATCTATTCA
GCTGATCTCTGGGATTCGCAGGGGCACTTTTAGCTTAGCT
TAGCATAAATGATTGAATTGGATTAGACCATTAGCGTCTC
GCTCAAGTAAAAGCCCAATAATTTAGATAATTTTTCTGTT
TAAAGCTTGACTCTCTTTTATTTACATTGTGTACCAAGAC
TGGTGGAAAATGTAAAGTTATTTTTTAGGCTGATATAGCT
AGTAAAAACTTAGCTTAGCATACATCATTGAATCGGACTA
GACCATTAGCATCTCGATCAAAAATGACCAACAAAA

bcap29 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA bcap29-201 1516
ncRNA bcap29-002 (1)    Ensembl 440
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
bcap29-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000008406 (1),  Ensembl_Trans:ENSDART00000007638 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC095391 (1) 1445 nt
GenBank:CK026821 (1) 758 nt
GenBank:EX155692 (1) 700 nt
GenBank:EB855615 (1) 479 nt
CITATIONS (2)