Transcript

si:ch211-217k17.9-002

ID
ZDB-TSCRIPT-110912-286
Name
si:ch211-217k17.9-002
Previous Names
  • ch211-217k17.9-002
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000052555 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000052555|OTTDARG00000019390|ZDB-GENE-061207-21 si:ch211-217k17.9|no_translation CH211-217K17.9-002 LG_ BX323839.13 Danio rerio protein_coding NOVEL, 774 bp
AGGAGTACCAGACAAGAGCTAACAATGTCAGGGCTGAGAT
TGAACCAATCTACAGAGCGAAGTATTCAAACTTCAAGAAA
GCCGAAGTCACAGGATTCAAGTAAATACTTTTTATTGTGA
TTCTCATATTTTATGTACACTGTGTATGAAACAGGAAGCA
AGGGAATAAAGGCTCTGGTATACTTCAAACTAATTTAACA
ATAAACTGAAATTACCTCATATTTGAACAAAATCTGGCCA
AAAGAAGTTCTTTTTAGTTCGTTTTGGCACTTTAAAACAG
CTTACAAAAGCAAACTTTTTTGCAATCAGTTGGTTTCTTC
TGGAAATCTGACTTCTTTGACCTGCAATTGTTCCCACTTG
ATTTCTTTTTGTTCCACGGGGGTCAGACAGGAGAACAGCA
TTGGCCACATAAATACATTAGAGAGTCAAGTAGCTGAGCT
GCAACAGATATATCCGCACCTGTACAATTGATTTTGAAGA
GATTTTATAGACTTGGATGGGTTGTCAGACCAGATGAGAA
ACCCACGTCGTCGCGTCACATCATTTTGTTAGTTGGTGTC
TGTGCGTGACATATAGAAAAACATGTGACAATGGCGGTTA
AGAGCCACTGTGGTGTGATGTATTTAAGGGTACATGCGAG
CAAGGTGGCAAATTTACAACTACTGCAGCATACCATCATA
CCGTATACAGTCACTACACCTATTTTAACTTATTTTTTAT
CCTCAAACAAAGAACTAAAAATAAATTAGCTTAAAGTATA
CCGGGGCCTTAGGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations