Transcript

si:ch211-217k17.9-201

ID
ZDB-TSCRIPT-090929-6766
Name
si:ch211-217k17.9-201
Previous Names
  • si:ch211-217k17.9-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000023804 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000023804|OTTDARG00000019390|ZDB-GENE-061207-21 si:ch211-217k17.9|OTTDARP00000019734 CH211-217K17.9-001 LG_ BX323839.13 Danio rerio protein_coding NOVEL, 1362 bp
CACCATCTACAGCTTCTACAAGTGCAGTGTCCTCACCATC
TACAGCTTCAACAAGTGCAGTGTCCTCACAATCTACAAGT
GCAGTGTCCACACCATCTACAGCTTCTTCAAGTGCAATGT
CCTCAGCATCTACAGTTTCTACAAGTGCAGTGTCATCACA
ATCTACAGCTTCAACAAGTGCAGTGTCCTCACAATCTACA
GCTTCTACAAGTGCAGTGTCCTCAGCATCTACAGCTTCTA
CAAGTGCAGTGTCATCACCATCCTCCGCTCCTACAAGTGC
AGTGTCCTCAGCATCTACAGCTCCTACAAGTGCAGTGTCC
TCAGCATCTACAGCTTCTACAAGTGCAGTGTCATCTGCAT
CTACAGCGACCTCACCATCTAGTGCTACTGCAGCATCTAC
AGTGTCCTCAACATCTACATCTACATCTACTACAGCATCT
ACAGCGTCCACAACTGCACAACAACCTGATACAGTAACAT
TACTGCAGTTTAGCTCCTCTGACACATTTACAGCTGCACT
CAATGACCCAACCTCTCAGGAGTACCAGACAAGAGCTAAC
AATGTCAGGGCTGAGATTGAACCAATCTACAGAGCGAAGT
ATTCAAACTTCAAGAAAGCCGAAGTCACAGGATTCAAAAG
CGGGTCAGTCGTTACTTTTACACGGCTCACTTTCACCTAC
AGCGAATCCAACCCAACCACTCAAGAGATTTCAAACACAC
TCCTGGCAGCAGCGGTTGCAGGACAAATCAATCAACTGAA
CATAATTCCTCAGTCAATTTCAGTCAACGGTACAGCTTCA
GCGACAACAGCAGCAACAACAGTAGCAGTAACAACAGCTT
CAAGTGGATTAAAGATTGAATCAAGTTTACTACAAGCAGC
ATGCCTCATTATAATGTCAAAATTATTCAAGTTTTTCCTA
CAGATGCCTTAATCATATATCAACAGAACTATGTTTTTAT
CATGAAACACACTGTAACAAATTAAACAAATAGAAAGTGT
ATTTTTGTTACATGGTAAATAATTCTACCACAATTACAAA
TAATGGTATCGGGCAATATAAAGATAATCTTGATATTGCA
TACTTTCTCAGGAATATTATTGCATATTTTAATTTAACAG
CAGGCTGTTCTCAGGGAGGGAAAAGTGGAGCTTTTTCCTT
ATCCTCTTCCTAGTGTATTTTTTAAGATGTACACATTGTA
AAAGATGTATTTTTCAGGATAAATACTGCTAAAGTGTCTT
TTTTGGTCTGTTAATCTCTAACATTGTAATATAAAATTGT
GTTTTAATCAATTAAATGTATTTATTAAGTTTGTATGGTC
TGGAATATGTTGTTTTGAAACACAATAAATACCATAAGTG
CT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations