Transcript

pdgfaa-202

ID
ZDB-TSCRIPT-110912-246
Name
pdgfaa-202
Previous Names
  • pdgfaa-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000052145 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000052145|OTTDARG00000036583|ZDB-GENE-030918-2 pdgfaa|OTTDARP00000040987 pdgfaa-001 LG_ BX072555.15 Danio rerio protein_coding KNOWN, 1464 bp
CACGCTCCGCTCCGCGCTTCAGGACCTGCTGAAGCTTCAC
CAGACACATTCTTTCATGAGGACACAACGTGGATGGTGCG
TCAAATGGACTATTCTGGATAAACGTGGACTCTTTGATTA
TACTAACTCGTTTTTTCGTCTAGGAACATTTTTGGATTTA
GATTTTGTATTATTCAAACACATTTCTGAAAAGATGCTAT
AAAAGGATGATATTTTAATGGATTAAAAGCGACAAGAAGT
AATTAGAGTCGATTTTAGGACTTGCTTTTCTGTTTGACTT
GTGAAGAGTTTATCCTTTGGGAGATTTGTCTGTAGAAAGG
CATGTTCCCCGGCTCCCCGCCGGTTGGAGCATCTCTGCGG
CTCCGGTCGGGACGGTTTCGCCTGCGCTGGGACACTTTTG
GACCACAGGGGAGATGAGAACCGCGCTGATCCACTTTCTC
GTCTGCTGCTTCTCTCTGCTTTCAGCAGCCGCTGAGGAAG
CACCAATTCCCCGAGAGCTGATTGAGAGACTCTCTAACAG
TGAGATCCACAGCATCAGCGACCTCCAGAGGATCCTGGAA
ATGGACTTCCTAGAGAATGAAGTGCTGGAGGATGTTAAAC
AAGGCCACCATAAGGAGCATCTGTACGACAGCAGAAACCT
CAAGAACTTGCACTCCAGACGCAAGAGAAGCATTGAGGAG
GCAGTGCCAGCCGTCTGTAAGACCCGTACGGTGATCTATG
AGATCCCACGAAGTCAGGTGGATCCAACAGCCGCCAACTT
CCTGATCTGGCCTCCGTGTGTGGAGGTGAGGCGATGCTCA
GGCTGCTGCAACACCAGCAACATGCGCTGCCACCCGTCCA
AAAAACACCACAGGAACGTGAAGGTGGCAAAGGTAGAGTA
TGTTCGACGGAGGCCGAAGCTGCGGGAGGTGCAGGTGCAG
CTGGAGGATCATCTGGAGTGTGTTTGCACGTCCAGACATC
ACTCAGAGTCCCGCATACACACAGCAGATATAAGGTGAGC
GTGGCACCAGATAAAAAAAAGGCAGAGGAGGGCATCAGAT
ATCAGGCTGAACCACAGCCATTGACTGATAAAATCTGAAG
ACACTCTTCAACAGCGAGCCAATCAGGGCGCAGCTCTTGG
ATCACTCTGGACTTTTCATGCACCTTTAAAAGGAACCCAA
ACTTGTGGGTTTGGATAAAAACCCAGAGGGATTACACAAT
AGACTGCAACGACAGCCTGAAAAACGAACTCAGACTTCTG
TCTCCACCGCCTTTTAAAGGAGAATCAATCATGACTTTAT
CTATCGAAATGTATATTTCTCCAGCAAATAACTGTATCAT
ATTATTTTTGTAACTGTCCGTTTTCTATCGACACTGATCG
TCTCTTGTATATATGCCGTAGAATGGACGAATGCAGCAAA
ACTCAATCTACAGTAACTCTTATACTAATAAAGCGAATAC
ATTTTATTGTGTTTGTTTCTCAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations