Transcript

fbn2b-201

ID
ZDB-TSCRIPT-110912-217
Name
fbn2b-201
Previous Names
  • fbn2b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000052035 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000052035|OTTDARG00000036528|ZDB-GENE-090112-3 fbn2b|OTTDARP00000040890 fbn2b-001 LG_none FP885838.7,CR751224.22 Danio rerio protein_coding KNOWN, 931 bp
GAGCAAATATCCCGTGACAATAACGGACTCCTCCAGGCAT
TCCGACGCATCTGAGCCTGGAGTGCTCTTGGATCAAGCTC
AAAATAGTGTCTGAAGAGCTCACTGGAAAGGAAGAGTTTT
ATTAAGGGTGAGGCACATTTACCGGCGCTTCAGGAGTCGC
ACAGCAGGGGCCAATGGGAGTGTGGAAGCTGGCCAACGTG
GTGCTATGGTGGGCCGCAGTCCATTCGGTGCAAGGGCAAG
GAGATGGAGACATCCAGGCCAGCCGATTCACTGGAAAACC
TGAGGGGGAGGTGCAGCAGAGGGTCCGGCGAAGGGGCCAG
GAGTCCCTCAGGGGGCCCAACGTATGCGGTTCCCGCTTCC
ACTCCTATTGTTGTCCAGGATGGAAAACGCTTCCTGGAGG
GAACCAGTGTATAGTTCCAATCTGTAGGAACTCCTGTGGT
GATGGCTTTTGCTCGAGGCCCAACATGTGTACCTGTTCGA
GTGGTCATCTTGCCCCTAGCTGTGGTGCGGCTGCTGTCCA
GTCCTGCAGCGTCAGATGTATGAATGGTGGGATGTGTAAT
GAAGACGCCTGCTCCTGTCAGAAGGGATACACAGGAACTC
ACTGTGGACAACCGGTGTGCGAGAGCGGATGTCAGAACGG
CGGCCGCTGCATCGGACCCAACAGATGTGCCTGCGTTTAC
GGTTTCACCGGGCCGCAGTGCGAGAGAGACTACCGGACTG
GACCGTGCTTCACTCAGGTCAACAATCAGATGTGCCAGGG
TCAGCTGAGTGGCATCGTGTGCACCAAAACGCTCTGCTGC
GCCACCATTGGCCGAGCGTGGGGTCACCCGTGTGAGATGT
GCCCTGCCCAACCACACCCCTGCCGGAGAGGATTCATTCC
CAACATCCGCACCGGTGCATGCCAAGGTAAGCACGAGCGT
CAACATTCCCG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations