Transcript

cry1aa-201

ID
ZDB-TSCRIPT-110912-152
Name
cry1aa-201
Previous Names
  • cry1aa-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000051722 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000051722|OTTDARG00000007625|ZDB-GENE-010426-2 cry1aa|OTTDARP00000040657 cry1a-003 LG_ BX005210.10 Danio rerio protein_coding KNOWN, 1984 bp
TGTCGTTTTTGTTTACGCATTTGAGAGCAGTTTCTTTTTT
GGAGAGTGTTGTAGAATAACCCTTGCATACTAAAAGCTGG
ACTTTAGTGGAGTAATGGTGGTCAATACAGTCCACTGGTT
CAGGAAGGGCTTGCGGCTCCACGACAATCCTTCACTCAGA
GACTCTATTCTGGGAGCGCACAGTGTCCGCTGTGTGTACA
TCCTCGACCCCTGGTTCGCAGGATCCTCCAACGTCGGGAT
CAGCAGGTGGAGGTTTTTGCTGCAGTGTTTGGAAGACTTG
GACGCCAGCCTCCGCAAACTCAATTCACGACTCTTTGTTA
TCCGTGGCCAACCCACCGATGTCTTCCCCAGGCTTTTCAA
GGAATGGAACATTAATCGTCTGTCCTACGAGTATGACTCA
GAGCCATTTGGAAAGGAGAGAGATGCTGCTATCAAGAAGC
TAGCCAATGAGGCAGGCGTGGAGGTGATAGTTCGCATCTC
TCACACGCTCTACGATCTGGACAAGATCATCGAGCTGAAT
GGAGGTCAGTCTCCGCTCACGTATAAGCGCTTCCAGACCC
TCATCAGCAGGATGGAGGCGGTGGAGACACCCGCAGAGAC
CATCACTGCAGAAGTCATGGGGCCGTGCACCACACCGCTT
TCTGATGACCATGATGAGAAGTTTGGAGTTCCCTCTTTGG
AAGAGCTCGGCTTCGACACAGAGGGCCTTTCCTCAGCTGT
GTGGCCAGGAGGAGAAACAGAGGCCCTCACTCGCCTAGAG
AGGCACCTGGAGAGGAAGGCTTGGGTGGCCAACTTCGAGA
GACCAAGAATGAATGCCAATTCGCTGTTGGCTAGTCCTAC
GGGCCTCAGCCCATATTTAAGATTCGGCTGCCTCTCCTGT
CGACTCTTCTACTTCAAACTCACAGACCTCTACAGGAAGG
TCAAAAAGAACAGCTCACCTCCTCTGTCCCTCTATGGCCA
ATTACTGTGGCGTGAATTCTTCTACACGGCTGCTACAAAC
AACCCACGCTTTGACAAAATGGAAGGGAACCCCATTTGCG
TGCAGATCCCATGGGATAAAAACCCAGAGGCTTTGGCAAA
GTGGGCTGAAGGCAGGACGGGTTTCCCCTGGATCGACGCC
ATCATGACCCAGCTGAGGCAAGAGGGCTGGATCCACCATC
TGGCCCGACACGCAGTGGCCTGTTTCCTCACCCGTGGAGA
CCTGTGGATCAGCTGGGAGGAGGGCATGAAGGTGTTCGAG
GAGCTGTTGTTGGATGCAGACTGGAGTGTGAACGCAGGAA
GCTGGATGTGGCTGTCCTGCAGCTCCTTCTTCCAGCAGTT
CTTCCACTGCTATTGCCCTGTGAGCTTCGGCCGCCGCACT
GACCCCAACGGAGACTACATACGGCGATATCTGCCAGTCT
TAAGGGGTTTTCCTGCCAAGTATATCTATGACCCCTGGAA
TGCTCCAGAAAGCGTCCAGAAAGCAGCCAAATGTATAATT
GGTGTCCACTACCCTATGCCCATGGTGCATCACGCTGAGG
CAAGCCGCCTTAATATAGAGCGTATGAAACAGATCTACCA
GCAGCTGTCTTGCTACCGAGGCCTGGGACTGCTGGCAATG
GTGCCGTCCAACCCTAATGGAAATGGGGAGAATTCCACAA
GCTTAATGGGTTTTAAAACTGGAGACATGACTAAGGAAGT
CACTACACCTTCAGGGTATCAGATGCCGCCCACCTCTCAA
GGAGAATGGCATGGCAGGACAATGGTTTACTCACAAGGAG
ACCAACAAACAAGCAGCATCATGACTTCACAAGGTTTTGG
CAACAATGGAAGCACAATGTGCTACAGGCAAGACGCACAG
CAGATAACAGGACGAGGCTTACACAGCAGCATCATCCAGA
CCTCTGGAAAACGACACAGCGAGGAGTCTGGTCCTACCAC
TGTCTCAAAAGTCCAGAGGCAGTGCAGCTCCTAAACATCA
GGTCATTCACAAAATGCATGTGCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations