ZFIN ID: ZDB-TSCRIPT-110325-987
Transcript Name: nr1d2a-201
Previous Name: nr1d2a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000047799 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000047799|OTTDARG00000033900|ZDB-GENE-040504-1 nr1d2a|OTTDARP00000037523 nr1d2a-001 LG_ CU855686.17 Danio rerio protein_coding KNOWN, 3081 bp
AGGAGGTGTGATAGCTTATGTCTGCTCCTCAAGCTCGGCC
TCCAGCCCTGAGTCCTGCATGAGTGACAGCTCTGCCAGCC
AATCGCCATCCTCCTCTCCTCCTCTGCCCACTAAAGCGAG
CCGTGCCACAGATCTGTCCATCAGCGCAGGAATGCTGAAA
CACACACGTGGACACACATCTGATAAAAGCCTCGCTAACA
AGAGCTCCATCACCAAGCTGAATGGGATGGTGTTGCTGTG
TAAAGTGTGTGGAGACGTCGCCTCTGGCTTCCACTATGGT
GTTCATGCCTGTGAAGGCTGCAAGGGCTTCTTCAGAAGAA
GTATCCAGCAGAATATCCAGTATAAGAAATGCCTGAAGAC
TGAAAGCTGCACTATAGTGAGGATAAACCGCAACCGCTGC
CAACAGTGCCGCTTCAAGAAGTGTTTATCCGTCGGCATGT
CAAGAGACGCCGTGCGTTTCGGACGCATCCCGAAGCGTGA
GAAGCAGCGGATGCTCCTGGAGATGCAGACGGCGATGAAC
AACATGATGAACAACAGTCAGCTCCAGCACATGCTGCACG
TTTCTCCGAGCGACTCGTCCAGCTCTTCTTCTGCATCTCC
GCCGGATTCCCCACGCTCCTCGACGGAGTCGCTCGTCCCG
ATGGACACCGCCTCGTCCTGCTCGTCCGACAGCGGAGAAG
AAGACGGACGATTCTCCTACAGTGCATCTGTTTCCCCGGC
CGCATCTGAAACACTCAGCAGGGAAGAAGAAGAGCCGCAG
ATGCAGTGCTGGAGACGCTCAGACTGTCAAAACACCACAG
GACCTTACAGGGAACAGACGGCGCAGCAGTGCATTCGCTT
ACCGACTGAAAACATGAGTTACTGCAGGAGGAACATGAAT
GAAGGAGGAAACCGAGCACATCTGGTTTGTCCCATGAGCG
CCTCCCCGTTTGTTGACGCCTCCAGACCCGGTCATGAAGT
CTGGGAAGAGTTTTCCAGGAGTTTCATCCCTGCCGTTCGA
GAGGTTGTAGAGTTTGCTAAGCGGATCCCAGGCTTCCAGG
AGCTTTCCCAACACGACCAGGTCAACCTGCTGAAGGCCGG
CACATTTGAGGTGCTGATGGTGCGTTTCGTGCCTCTATTC
GACGTGCAGCAGCGGACTGTGAGTTTCATGAGTGGCAGAA
GGTACAGTGTGGACCTGCTGCGCTCCATGGGGGCCGGAGA
GCTGCTCAACTGCATGTTCGAGTTCAGCGAGAAACTCGCC
GCTCTGCAGCTCAATGACGAGGAAATGAGCCTCTTCTCTG
CTGTGGTGCTCGTGTCTGCAGACCGATCAGCAATTGAGGA
CGTTGTCGGTGTGGAGGCCCTTCAGGAAAGCCTAATCCGA
GCCCTGAGGAACCTAATCATGAAAAACCACTCAAACGAAT
CCTCCGTGTTCACCAAACTGCTCCTAAAACTGCCTGAGCT
GCGATCGCTCAACAACATGCACTCCGAGGAGCTGCTCGCC
TTCAAAATACAACCCTAAACAACCAACCTGCGCTCTCCAT
TTTACTCTTGAATGTATTTAACAGGCTTTTATACTGAATA
ACGACGCATTCGTACGCTATTATTAGATATTGTGATATTT
GCTAATGACGCACAAGCGAAAGCGAAAAACGTTTGTTTTT
TAAAACACATGAAAGACTCTTCCTCTTTTATTTATGTGCA
ATAGCTGCTAACGCATGGCTAGTCGTATAAGAGCAGCTTT
ACGTCGTGTTTGTCCAGAAGAGTTTGTATTGATTAAGGCC
AGACGCTGCAGGCTTTTTAGGCTTTTCATAAATGCCAAGT
AAACATGCACTTAAAAAAAGCATAAAAAATATAAACTTTA
TCTTTTTTTGCACTTTTTGTAAATTTCAGTCACAATACAT
ATTTTAAGACAATACATATTTTACATATTTTTTCATCTCA
ACTAAGCCACAAATTGCTTTTTTAGCACTGTTTATGTACA
TTAAACATCACAGTTTTGCAGGAACTACTTTATCTGTGCA
TTTAAATATCATCACGTTTTAGAATGCTCCAAATTGGCCG
GAACTACTTTATCTGTGCAGTAAATAACATCATGTTTTAG
AATGCTCCAAATTGGCCGGAACTACTTTATCTGTGCATTT
GAATAGCAGTCGACATTTAATTAGCAGTCGATTTTAAAAT
GCTCAAAATCTGCAGGTACTACTTTAAATGTGCATTTAGG
AAACAGCACATTTAAGAATGCCCAAAATCTGCCGGAACTA
CTTTGTCTGTGCATTTAAATAGCAGTCTATTTTAGAATGC
TTAAAATCTGCCGGAACTACTTTATCTGTGCATTTAAGTA
ACAGCACATTTTAGAATTCTCAAAATTGGCCGGAACTACT
TTATCTGTGCATTTAAAAAGCAGCACATTTTAAATGCTAA
AAATTGGCCAGAATTAATTTATCTGTGCATTTAAATAGCA
GTCGATTTTAGAATACTCAAAATTGGCCAGAACTACTTTA
TTTGTGCATTTAAACAGCAGCACATTTAAGAATGCTCAAA
ATTGGCCGGCACTAATTTATCTATGCATTTTAAACAGCAG
CACATTTTAGATTGCTCAAAATCGGCCAGAACTACTTTAT
CTGTGCATTTAAATAGCAGTTGATTTTTGAATGCTCAAAA
TCTGCCGGGACTACTTTATCTGTGCATTTAAATAACAGCA
CATTTTAGAAAGCCTAAAATTTGCCGGAACTACTTTATCT
GTGTATTTAAATAATAACACATTATAGAATGCGCTAAATC
TGCCGGAACTACTTTCTCTTTGTATTTTAATAATAGTACA
TTATAAAATGCGCTAAATCTGCGGGAACTACTTTATCTGT
GCATTTAAATAGCAGTTGATTTTAGAATGCTCAAAATGGT
CTGGAACTAATTCATTTGTGCAATTAAACAGCAGCACATT
TTAAAATGCTCAAAATCTGCCAGAACTACTTCATCTGTGG
ATTCAAATCATAGCACATTTTAGAATGCCCATCAGCCAAT
CAGAAGCAAGCATTCAACAGCCCTGTAGTATAATGATAGC
TTTTTATTTTTAACCCTTTTTTTCGCCTGCAGTGTCTAGC
C

nr1d2a TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA nr1d2a-201 3081
ncRNA nr1d2a-002 (1)    Ensembl 450
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
nr1d2a-201 Contained in:
[BAC] CH211-231M23 (1)

Genome Resources: Vega_Trans:OTTDART00000047799 (1),  Ensembl_Trans:ENSDART00000128167 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC162908 (1) 3360 nt
GenBank:AF342941 (1) 1211 nt
GenBank:EB949557 (1) 711 nt
GenBank:EB951322 (1) 664 nt
GenBank:EB928557 (1) 593 nt
GenBank:EB782110 (1) 402 nt
CITATIONS (2)