Transcript

nr1d2a-002

ID
ZDB-TSCRIPT-110325-79
Name
nr1d2a-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000047798 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000047798|OTTDARG00000033900|ZDB-GENE-040504-1 nr1d2a|no_translation nr1d2a-002 LG_ CU855686.17 Danio rerio protein_coding KNOWN, 450 bp
AGGAGGTGTGATAGCTTATGTCTGCTCCTCAAGCTCGGCC
TCCAGCCCTGAGTCCTGCATGAGTGACAGCTCTGCCAGCC
AATCGCCATCCTCCTCTCCTCCTCTGCCCACTAAAGCGAG
CCGTGCCACAGATCTGTCCATCAGCGCAGGAATGCTGAAA
CACACACGTGGACACACATCTGATAAAAGCCTCGCTAACA
AGAGCTCCATCACCAGTGAGTACACACACACACACACACA
TACAAACACAGTGAGCACATCTGACAGGATTTACCGACTC
TGACGTGTGTTTTCTAGAGCTGAATGGGATGGTGTTGCTG
TGTAAAGTGTGTGGAGACGTCGCCTCTGGCTTCCACTATG
GTGTTCATGCCTGTGAAGGCTGCAAGGGCTTCTTCAGAAG
AAGTATCCAGCAGAATATCCAGTATAAGAAATGCCTGAAG
ACTGAAAGCT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations