ZFIN ID: ZDB-TSCRIPT-110325-929
Transcript Name: gtf2h3-201
Previous Name: gtf2h3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030048 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030048|OTTDARG00000023125|ZDB-GENE-040718-302 gtf2h3|OTTDARP00000024505 gtf2h3-001 LG_ CT978957.10 Danio rerio protein_coding KNOWN, 1198 bp
CTGAGTTCAATCTCTCCATTGAATAAACAGAAGAAAATTT
AAGCATGAGTCCAAACAGCACAACTTTCAACATATTGAAG
AAAACAGCAAAGAAATACAGTTTCATATCAATTTAGAGAC
GCCGGAATTGCAGCAATGGCTTCGGACGATGATATTAATA
TTCTGGTCATAGTGCTGGATGTGAATCCTGTGTGGTGGGG
TCAGCAGGCGCAGCGGGAGCCAAAGTTCACCCTTTCAGCA
TGTTTGGACAGTTTGATGGTCCTGGCAAATGCTCATTTGG
TCATGTCAAGGACCAACAAACTAGCCGTCATCACCAGCCT
GTATCACGAAAGCCACTTCTTGTATCCCAGTAAGCAGTGG
AGATCTGGGGAGGAAATCTCTGCAAACCCCGACGGCAAAT
ATGAGCTTCTCTCAGTCACCAATGATCTGTTTGCAGAGGA
GATCAGGAATCTGATGGAAAGAGCGGAGGTCAGCGGCAGT
CAGACGGAAACACTGTTGGCTGTGTCTTTGGCCAGAGCTC
TGTGCTACATTAATCGAATCTCAAAGGACGTGCAAGCTGG
TCAGGAGGTGAAATCGAGAATATTGGTAATAAAAGCTGCT
GAGGATTCTACATCTCAGTACATGAACTTCATGAATGTGA
TTTTTGCAGCACAGAAGAAGAATATCCTGATTGATGCCTG
TGTGCTGGACTCGGACTCTGGACTTCTACAGCAGGCTTGT
GACATTACCGGAGGCTTGTATCTCAGAGTTCCTCAGAAAG
TTGCTCTCACACAGTACTTATTGTGGGTTTTCTTACCAGA
CGCAGAGCAGCGTTCACAGTTATTGCTGCCTCCTCCAGTG
CATGTGGACTACAGAGCCGCCTGCTTCTGCCACCGCAACC
TCATAGAGATCGGATACGTCTGTTCAGTCTGCCTGTCGAT
ATTCTGCAACTTCAGTCCAATCTGCACAACATGCGAGACT
GCCTTCAAAATGCCTCTGCCTCAGATGGCTAAAACCAAGA
AGAAAAAGCTGAAAACTGCAAACTGATTCGTCTGTCGTGT
CACTCAATGTGCTTTAATTATCTCACATTAATGTCTTTTT
GAACAGCATACCCTTATAATTTAATATTTGGTTATAACTT
GTGTATATTTGAACACCCTTTTCTAATGTAGCCTTCGCTT
TAAATAAAAGACAGTTTTACATAAAAACAAAACAAGAA

gtf2h3 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA gtf2h3-201 1198
ncRNA gtf2h3-002 (1)    Ensembl 696
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gtf2h3-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000030048 (1),  Ensembl_Trans:ENSDART00000097244 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC076236 (1) 1180 nt
GenBank:EH506768 (1) 1025 nt
GenBank:CK681196 (1) 651 nt
GenBank:CN511243 (1) 602 nt
CITATIONS (2)