ZFIN ID: ZDB-TSCRIPT-110325-1838
Transcript Name: gtf2h3-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030049 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030049|OTTDARG00000023125|ZDB-GENE-040718-302 gtf2h3|no_translation gtf2h3-002 LG_ CT978957.10 Danio rerio protein_coding KNOWN, 696 bp
GAAGAAAATTTAAGCATGAGTCCAAACAGCACAACTTTCA
ACATATTGAAGAAAACAGCAAAGAAATACAGTTTCATATC
AATTTAGAGACGCCGGAATTGCAGCAATGGCTTCGGACGA
TGATATTAATATTCTGGTCATAGTGCTGGATGTGAATCCT
GTGTGGTGGGGTCAGCAGGCGCAGCGGGAGCCAAAGTTCA
CCCTTTCAGCATGTTTGGACAGTTTGATGGTCCTGGCAAA
TGCTCATTTGGTCATGTCAAGGACCAACAAACTAGCCGTC
ATCACCAGCCTGTATCACGAAAGCCACTTCTTGTATCCCA
GTAAGCAGTGGAGATCTGGGGAGGAAATCTCTGCAAACCC
CGACGGCAAATATGAGCTTCTCTCAGTCACCAATGATCTG
TTTGCAGAGGAGATCAGGAATCTGATGGAAAGAGCGGAGG
TCAGCGGCAGTCAGACGGAAACACTGTTGGCTGTGTCTTT
GGCCAGAGCTCTGTGCTGTATCCTCTAACACCGCTGTATA
ATACACACATCCACAGACTGCTATTGTTTTCATTAACAAT
TCACTCTCAGACATTAATCGAATCTCAAAGGACGTGCAAG
CTGGTCAGGAGGTGAAATCGAGAATATTGGTAATAAAAGC
TGCTGAGGATTCTACATCTCAGTACATGAACTTCATGAAT
GTGATTTTTGCAGCAC

gtf2h3 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA gtf2h3-201 (1)    Ensembl 1198
ncRNA gtf2h3-002 696
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gtf2h3-002 Contained in:

Genome Resources: Vega_Trans:OTTDART00000030049 (1),  Ensembl_Trans:ENSDART00000148734 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CK679569 (1) 706 nt
CITATIONS (2)