header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-922
Transcript Name: ctsk-201
Previous Name: ctsk-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000023159 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000023159|OTTDARG00000018948|ZDB-GENE-001205-4 ctsk|OTTDARP00000019277 ctsk-001 LG_ AL954306.10 Danio rerio protein_coding KNOWN, 1639 bp
CTATTCCAGATATTCTTCCCTTCCCCTCAACAAGAGCAAC
TTCCTCAAAACTTCCTCATAAAAAGAGGCCATCGACCGTT
TCAATCCCGCAGCCTTCTGTTGTTCTGAACTTTTGGAAAT
CGCTCAGGTCAGAATGGGTAGATTTGGCGGATTCCCTCTG
CTGGTGGTGCTGTGGTGTGGACTGGCTCACTCTCTGGACA
ATCTCTCTCTGGATGAGGCTTGGGAGAGCTGGAAAATCAC
TCACAAGAGGGAGTACAATGGCCTGAATGAGGAGTCTATT
CGACGGACGATTTGGGAGAAGAACATGCTGTTTATTGAGG
CCCATAATAAAGAGTATGAACTTGGGATTCATACCTATGA
TCTGGGCATGAACCATTTTGGTGACATGACACTAGAAGAA
GTGGCAGAGAAAGTGATGGGTCTTCAGATGCCCATGTACC
GCGATCCAGCAAACACATTTGTGCCTGATGACAGAGTGGG
AAAGTTGCCCAAATCAATTGACTACCGTAAACTGGGATAC
GTCACTTCGGTGAAGAACCAAGGATCATGCGGCTCCTGCT
GGGCGTTCAGCTCTGTTGGTGCCCTTGAAGGCCAGCTGAT
GAAGACCAAAGGTCAGCTGGTGGACCTCAGTCCTCAGAAC
CTGGTGGACTGTGTGACAGAAAATGACGGCTGTGGTGGAG
GATATATGACAAACGCCTTCAGATACGTCAGCAACAACCA
AGGCATTGATTCAGAGGAGAGCTACCCCTACGTTGGAACG
GATCAGCAGTGTGCCTACAACACTTCAGGAGTAGCAGCCA
GCTGTAGAGGCTATAAAGAGATTCCTCAGGGTAACGAGAG
GGCACTGACCGCCGCCGTGGCCAATGTGGGACCCGTGTCA
GTTGGCATAGATGCCATGCAGTCCACCTTCCTGTACTACA
AAAGCGGTGTATACTATGACCCAAACTGCAACAAGGAAGA
TGTCAACCACGCAGTGCTGGCTGTGGGCTACGGAGCCACA
CCGAGAGGCAAGAAGTACTGGATTGTGAAGAACAGCTGGG
GTGAAGAGTGGGGAAAGAAGGGCTATGTCCTGATGGCTCG
TAACCGAAACAATGCTTGCGGTATTGCAAACCTGGCCAGT
TTTCCCGTCATGTGAGAGCTGGAAGAACTAGATCAAACTT
GTCTGCTGCTGACCAGTACCAAAAAAGGGACTCAATCACT
ATCACTGCAACATGAAACCATGCTTGGGGAAATGCTTTCA
AAAAGAGGCATTTGATTTTAATAACACAAGGTTGTGGTCC
TATTTTGTCTTAGATGTCTTGTTCTTTATCCAGCAGTAAG
AATTGTTTTGTGCAATATTTGAGATTTAGAAGGGAAGTTT
TGATATTGAGTATGCAGTCAGTTTATATTTGATTCTTTCT
TTCCTTTTTTTATTCCCCTGGAGGGATCGGATCTCTGAAA
CACGTGTTTTATGATGTTTTGATTAAAGAAATTACTTTTT
TGACCATTAATTCTGAGTGCATCACATTTGAGTACATCAA
ATATGTCTGATGTAAGTTTTTAAATTACACTAACAGACTG
ATAGCGAGACAGTTTCACATCTCTGTACAGAAACATTGTT
GAAATAAAATCTAAACAATAAAACTTGAGTGCCAAACCA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ctsk-201 Contained in:

OTHER ctsk-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000023159 (1)
  • Ensembl_Trans:ENSDART00000011497 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC092901 (1) 1595 bp
    GenBank:EH468672 (1) 914 bp
    GenBank:CK865663 (1) 912 bp
    GenBank:EH474791 (1) 864 bp
    CITATIONS (2)