ZFIN ID: ZDB-TSCRIPT-110325-899
Transcript Name: hps5-002
Previous Names: ch211-112d9.2-002, zgc:162420-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000051141 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000051141|OTTDARG00000035886|ZDB-GENE-070410-80 hps5|no_translation CH211-112D9.2-002 LG_ CU184832.20 Danio rerio protein_coding KNOWN, 486 bp
AGCGGGCACAAACACACACGACCATCAGTTTACACACTAT
ATGACTCGTTTTTACTACGTTTCTGGATATTTCGCCGATT
TAAATGCGTCTGGAGCTCAGGAGGAGACCGGTGCAGGATG
ATTCCTGTGGTTCCTGTGGAGTCCTGCACTCACGTCCTGG
CAGAGTTTGACTGTCTGGACCCCCTGCTTTCTGCCCTGCG
ACTGGACTCCGGACGCATCAAAGTAAACCGCACATTTACC
GCCACAGTTTACTGTTGTGATAAGTTTTTATGGCGATCGC
TTTGGGTTATTCAAACTGACCTGAATCGCAGTTTGTGTTG
TTTACCTTTCAGCGAGCGTTTCTCAGTTTCTGTTCTGTTT
ATTTGATTTCCTGCTGTAAGAAATATTCCACGAATGATTG
AATCTGACAGACATAGTTGGGTCTTAACAGTTAAACAAAA
AAAATCATAAGTCCAAGGCACTTGAAAAGTAATTATTAAT
ATTCCT

hps5 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA hps5-201 (1)    Ensembl 4125
ncRNA hps5-002 486
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hps5-002 Contained in:
[BAC] CH211-112D9 (1)

Genome Resources: Vega_Trans:OTTDART00000051141 (1),  Ensembl_Trans:ENSDART00000148696 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH487888 (1) 595 nt
GenBank:EH499638 (1) 591 nt
GenBank:EH514275 (1) 578 nt
GenBank:EH525886 (1) 571 nt
CITATIONS (2)