ZFIN ID: ZDB-TSCRIPT-110325-2714
Transcript Name: hps5-201
Previous Names: hps5-001, ch211-112d9.2-001, zgc:162420-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000051140 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000051140|OTTDARG00000035886|ZDB-GENE-070410-80 hps5|OTTDARP00000040198 CH211-112D9.2-001 LG_ CU184832.20 Danio rerio protein_coding KNOWN, 4125 bp
GGAATTGCAGCGGGCACAAACACACACGACCATCAGTTTA
CACACTATATGACTCGTTTTTACTACGTTTCTGGATATTT
CGCCGATTTAAATGCGTCTGGAGCTCAGGAGGAGACCGGT
GCAGGATGATTCCTGTGGTTCCTGTGGAGTCCTGCACTCA
CGTCCTGGCAGAGTTTGACTGTCTGGACCCCCTGCTTTCT
GCCCTGCGACTGGACTCCGGACGCATCAAATGTACATGTC
TGTCAGTGTCCAGAAAGTGGCTGGCTTTGGGCACATCTGC
TGGAGGACTTCACCTCATCCAAAGAGACGGCTGGAAGCAG
AAACTCATTCTCACACACAAAGAAGGCTCCATCACGCAGG
TCTCCTGCTGCCCTCATGATGAGGACTTCATCGCTGTGGC
CACCAGTCAGGGTTTGGTGGTGGTGTGGGAGCTTCATCTG
GAGCGCCGTGGACGTCCGGAACGCGCCTCTGTGTCTTGGG
AGCACCGTGGAGTGACCGTAACATCCCTGTGCTGGGACAC
CGTGGCCCTCCGGGTGTTTGCTGGAGATATGGGTGGGAAG
GTGTCCTGCGTCCGGGCTGGGTCATCTAAACTCGGCAAGG
GCTCAGCGTTTGTGATCTTCCCAGTTCAGACCGTCACCAC
AGTGGATTCCCGCGTGGTTCAGCTTGGATACACTGATGGA
CACCTGGTGATCTCGTCCCTCAGCCGCTGCTACCTGTGTG
ACACAGAGAGGGAGAAGTTCTGGCGTGTGGGTAATAAGGA
GCGGGACGGAGAGTTCGGGGCATGTTTCCTCACTCAGGGT
CTGGCAGGTCAGCGTGGTCAGCTGGTCGGTTGTCCTGCTC
CTCTGCTGTTCTGTGCTCGTCCCGGATCCCGCATATGGGA
GGCCAGTTTCAGCGGAGAGGTCCTGAGCACACACCAGTTC
AAACAGCTGCTGGCCGTCCCGCCGCTGCCACTTGTCTCTT
GCAAGAATGAGCCACATTTCAATCCCACACAGACAAATCC
ACAGTCTCTGGCTTTCCCAAGACTCCTTCAGTTTGGTGAT
CAAAATCTGCTCACCTGGACGGATTCGGCCATCTACATCT
TCACTCCACACAGTGGTCAGGTTTTGCTCTGGACAGAGGT
CAAAGATGTGTTGGAGATCTCAGTTTTCCGTAATGACCTG
TTTTGTCTACACGGGGATGGACATTTGTCTCACATGTCGC
TGGTGTCGCCGGACCGCTGTGTGGAGCGACTGATGAAAAG
GGAGAACTGGACCATAGCCGCCACTGTCTGCTGCATGTTT
CAGCATGCTATTACTACATCCAAAGCCAGGAAGTCCCTAT
CCATTGATCGACTTGAACACCTCAAAGCTCAGCTAAACTC
CACCTCCCAGCAGCAGCTGATTGGTCAGCTGGAGGAAGTG
ATCAGCAAACTGGAGCCTCTGGATTCCGCCTGCAGCAGCC
GCAGAAGCAGCATCTCCTCGCATGAGAGCTTTAATGTTCT
GGACTGCGGCATCTACCGCGTGATCAGCCGAAGAGGCAGC
CAATCAGACGATGACGCCAGCTCTCTCGCCAACCAATCAA
TGCTCGAGGAGGAGCGGTTGAAGGAGTTCAGCTTCACCGA
GGAGGAGCAGGTGGATAACGACTCTGCGTCTGTGCGTGGA
GAGGGCGACCGGTCTGACCTCGGCTTGCAGTTTCTACCAT
TGCCTTTCCGCTCAAAACCTCCACGAGTCGCCCTGCAGGC
TGTTCGAGACAGTGTTTCCAGCTTCATGAAAAAGACCACA
GAGAAGATCAACACTCTTCAGATGAACGCTGACCTTTGGC
CTCGGCCTGACCTCCGGGAGGGCGTTCAGGGTGAGGTTGC
TTCCACAGCGAGCCCCATTTCCGAGGAAAGCGAGCAGGAG
TTAAACACTGAAGAGTCCAGCTCTGAGTCTGAGCTGCTGG
AGCTGAGAGCCGCTACTAAGAAAGCCATCTCTCAGATCCA
GGACCCGATGGTTTTACTGGACCCTCTCTGCCTCAGTGAT
GTGCTTCAGGAGTGGGCTCCAGTTCTGGAGAGAGCTTTGG
GTCCGGAGGATCAAATCCTACCTGTAGAAACAACAAATCC
AGAGGAGAAAACCCTGGAGGAGGAAGAGCTCGTCTCATCA
ATGTCTTGCTGCGTCGTGGTCCAACCAGAGATCTCAACAT
CGCCTGCTGCTGACCCAGATGAATCCGCAACCCACACTGA
AGAAGAGGACTTTAGAGAGAGCACCCCCTGTTCCATCGCC
CCAGTCCGAGCACAGTTCCCTCCTCTTGCAAACCATGTTG
AACTCATACAGCTGTTTTCCCCCAAACCTCTGCCTCCTGA
CCTGCAGGCTGACCTCTCGCTGCTGGCCTGTCTGTATCTG
GAGATGGGATGTCCCGGGAGAGGAGGGATGGAAAGCGTGT
GTGTGTTCCTGAGGAGGTTCTTCTTCCTGTTGGACCAGGA
AAGAGTGAGGAGGATGTGTATGCTGAGGTACAGGGAGAAC
CGTGAGGTGCTGAAGGCCTACATCGCTGGCATGCTGGAGT
TCACTCAGGCCAGTAAAGTAGTGGAGGTGATCCAGAAGGG
GGATCTGCTGAAATCTCTGCGCAGTTTAAGAGAACTGCAG
CCCTGGAACGCTCCTCTGCTCCTCTCACACCTCTACAGGC
TTTATGAGAAACATGGAGAGGTGGCTGTTCGAGCATACCC
GCAGTTCTATCCCACAATCCTCCCCTCTGACATCATGGCC
ATGGCTTTACCCAGCCACTTCCTGCCTTATTTGGACAATT
TAGTCCAGTCACGGGCTGAACAGCAACGGCTGTCGTTTTT
GGGCTCTCTTCTTCAGCCAGAAACTCTGCGTCAGGATTGG
CTGGAACTGGCGCTATCCCATGATGCTCCACAAAGAGAGG
ATACACTCACTCATGATGGACAGCCCAGGTGGCACTCTCA
CTTCTTCAGCTGGGGTTATGGGCGTCTGCTATCTCTGCTG
ATCCGCCTGCCTGCTGATCTGGCCTCTAAACAGAAGATGC
TGGACATGTGTAAAGCTCACGGGTATTGGATGGGTTACCT
GTACCTGTGCAGAGAGCTGCAGCGGCGGGCCGAGGCCTTC
AGTGCCATCTGCAGACTGGACGACATGACACTACTGGAGG
GGGATGATGGTATTGTTCCTCAGTCTCTGGATGAGTGGGT
TTTGCTGCTGCAGCTTTCTCAGCAAATCAGTGCAAGTGAT
GAATCATCGTTAACTTCGACAAAAAACAGCAATGGCTCAT
GTTTGGATGACGCTAACAGTAATGGTGACTGCTCTTCTGG
CCTATCAAACGGTTCCACAGACTGGAGCATTCAGGTCAGT
CCGGAGAACATCATCCTGCGTTTGGTGCGAGTCTTCGGGC
CGGACCGAGCCCTGACAGCCCTGCAGGAGCATGGCATACC
AGTTGATCACAGTTCACGCTCCACGCTGGTCTGTGATCTG
CTGCGAATGGCAGAGAAACGGCAAAGAGCTTTGATTCAGA
GCATGCTGGAGCGCTGTGATCGGTTTCTGTGGTCTCAGCA
CGCTTGAGTCTCCTCCGCATCTGCCTTCAGGACAGTCATG
TTTCATTCAACCGCAGGTCTGGGATCAGCTCTTGCGTGCA
GCTGGAGATTACACAGCCGACTGTTTCTAGATCAGCTGAT
TTCAGGTTATTGGACACGCATTCCAGTCTTAACACAGATT
CCTATTCATAGCTTTTTCACACCAGCACTATGACTGTATT
GTGTTGTAAATGATGCGTGAATGTCACATGACGTGGTTTT
CTCCTTATTTAGCTATTAAACACAGTATGGTGTTGAAACC
GTATTAACTATGGGCCTTTTTAATGAATATAAAAAAAATC
CATTTGTACATAAATGCTTTCCCTACATTTCTTGTGTTCA
TTATTAAGGCCCAGTATGCTGAATGCATTTCTATACATAT
ATATTACTTTACAATGTGATTTTCATCTGCAAGTATTTGA
GAACGCTAATAAGCACATAAGTTAAAAACTAACTAGAGTG
TTCTTTAAATAGAGAAAATTAAAAATAATTGCAAATGTAT
TAACTAATGCCATGCGGTTTGGCTGGTTTAACTGGCTGCT
ATTAATAAAAAGCACAATAAATAGCAGTACATGCTAATTA
AAAAA

hps5 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA hps5-201 4125
ncRNA hps5-002 (1)    Ensembl 486
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hps5-201 Contained in:
[BAC] CH211-112D9 (1)

Genome Resources: Vega_Trans:OTTDART00000051140 (1),  Ensembl_Trans:ENSDART00000104835 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC121196 (1) 4146 nt
GenBank:CN510950 (1) 893 nt
GenBank:DY575410 (1) 823 nt
GenBank:CK028792 (1) 774 nt
GenBank:GO942818 (1) 600 nt
GenBank:EB928715 (1) 521 nt
CITATIONS (2)