Transcript

neu4-201

ID
ZDB-TSCRIPT-110325-886
Name
neu4-201
Previous Names
  • neu4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000051099 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000051099|OTTDARG00000035857|ZDB-GENE-050522-125 neu4|OTTDARP00000040162 neu4-001 LG_ CU694447.8 Danio rerio protein_coding KNOWN, 1411 bp
CCTTGCGACCTCTTGCTCTCACTCATCTGACACTCATCTC
ATTACTCTGCATTAGAGCGTGTCCTGCCTGTTTGCTATAT
ATGAGGCTATGGGGTCTCAATACTACCCAGCACGATCCAT
ACTTTTCCAAAAGGAGCCGAGTGGAGTTACATACCGTGTG
CCAGCTCTGATCTACATCCCTCGCTCCAGCTGTTTCTTGG
CCTTCTGTGAGGAGAGACTGACTCCAGCAGACGCTCAAGC
ACATCTGCTGGTCATGCGCAAAGGGACGTTTTACAAAAAC
TATGTGGAATGGAAAGACATGGAGGTGCTCAGTACAGCTC
GACTGGAGGGCTACCGATCCATGAACCCATGCCCCGTTTA
TGACGAGTTTACTGACACGATCTTCTTGTTTTTTATTGCT
GTCCTGGGGCACACTTCTGAGTCTTATCAGCTAATTACAG
GAAAAAACGTGACGCGTCTTTGTTACGTTTCCAGCTGTGA
CCAGGGGGACACCTGGAGCAACGCTACAGATCTCACCAGG
ACACTGATAGGGGACACTATAAAAGAGTGGGCCACTTTTG
CTGTTGGTCCAGGTCACGGAACGCAGTTGAAATCTGGAAG
GCTAATAATCCCTGCATATGCCTACCACATTGACTGCAGA
AACTGCTTCGGCAAGACGTGCAAGACCTCGCCACACTCGT
TTTGTTTTTACAGTGACACACATGGAAACGTGTGGCATTT
TGGACAGGCGTTGTCTGAGCCTAACAGTGTGGAGTGTCAG
ATGGTGTCAGTGGATGAAGAAGATGGAGTCAACCTTTTGT
ACTGTAATGCGCGTAGCATTTCAGGCTACCGGGTGCAAGC
TGTCAGCTTTGATCATGGAACTTTCTTTCAAGATGGCCAG
CTGGTGCACAAACTACTGGAACCCAGAAACGGGTGCCATG
GCAGCGTGATCGGATTTCCAGCCCCAATCTTCCAGCTCGA
GCGGTTTAAGTCCATCTACAACTCACTTGAACTCAGCGCA
GCTCCGAGGTCTCCAAAGAACTTCCTTCCACCAACATGGG
TAGTATATAGTCACCCAACCTGTCCAAATTCCCGTCGTGA
CCTGGGGGTTTACCTCAGTCTTCTGCCTCGAGACCCAGAC
AGTTGGTCAGGACCTTGGATTATATATGACGGCCCTAGTG
CATACTCAGACTTGGCGTATGTTGACCTGATGTCTTCTGA
TGCCGCAGGGGTCACCGTCTTTGCCTGTCTCTTTGAAAGC
GGCACCAAGACAGCTTATGATGAGATTTCCTTCTGCATAT
TCACACTGTATGAGCTCATTGACCACCTTCCCCAAGACCA
AGAAAAAACAACATTGCTGAAGAGGAAACGAATCTGGGAG
CGCTGCTTTATCTGCTGATTATATGCCAATCTCTGTTGAG
TAGAAATCAGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations