Transcript

hcn4l-202

ID
ZDB-TSCRIPT-110325-843
Name
hcn4l-202
Previous Names
  • hcn4l-001
  • dkeyp-74b4.2-001
  • si:dkeyp-74b4.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050904 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050904|OTTDARG00000035741|ZDB-GENE-110411-3 hcn4l|OTTDARP00000039977 DKEYP-74B4.2-001 LG_ CR450817.7 Danio rerio protein_coding NOVEL, 2912 bp
CCTCCAGGTTTTACTGGGACCTGATCATGCTTCTTCTAAT
GGTGGGCAACCTGATCATCATTCCCGTGGGCATCACCTTC
TTCAAAGACGAACACACACCCGCCTGGATAGTGTTTAACG
TGGTCTCCGACACCTTCTTCCTGGTCGACCTGGTGCTGAA
CTTCCGCACGGGGATTGTGAAAGAGGACAGTACAGAAATC
ATCCTGGACCCTCAGCAGATCAAGGTCAGGTACTTGCGCA
GCTGGTTTGCCGTGGATTTCCTCTCCTCCATCCCTGTGGA
TTACATCTTCCTCATTGTGGAGACACGCATCGACTCGGAT
TTCTACAAGACGGCAAGAGCGTTGAGGATTGTGCGTTTCA
CCAAAATACTGAGTCTGCTTCGGTTGTTGAGATTGTCCAG
GCTCATTAGATACATCCACCAATGGGAGGAGATTTTTCAC
ATGACCTATGACCTGGCTAGTGCCATGGTGCGCATTGTAA
ATCTCATTGGGATGATGTTGTTGCTGTGCCACTGGGACGG
GTGTTTGCAGTTCCTGGTGCCCATGTTGCAGGATTTCCCT
TCAGACTGCTGGGTGGCCAAAAACAAAATGGTGAACGACA
CATGGGGTCAGCAGTACTCTTATGCCCTGTTTAAGGCCAT
GAGTCACATGCTGTGTATCGGGTATGGCATGTACCCTCCT
GTGGGCATGACGGATGTGTGGTTGACCATCCTCAGCATGA
TCGTGGGCGCAACCTGCTATGCCATGTTTGTAGGCCACGC
CACCGCCCTCATTCAGTCACTGGACTCATCACGCAGACAG
TACCAGGAGAAGTACAAGCAAGTGGAGCAGTACATGTCCT
TCCACAAACTTCCAGCAGACATGCGGCAAAGGATCCATGA
TTATTATGAGCATCGCTATCAGGGCAAGATGTTTGATGAG
GAGAGCATTCTGGGAGAACTGAACGAGCCGCTCAGAGAGG
AAATAATCAGCTTTAACTGTCGAAAGCTTGTTGCCACAAT
GCCGTTGTTCGCCAATGCGGATCCAAATTTTGTGACCTCC
ATGCTCACCAAGCTGCGTTTCGAGGTGTTCCAGCCAGGAG
ATTACATTATCAGAGAAGGGACCGTCGGCAAGAAGATGTA
CTTTATACAACACGGTGTACTAACTGTCCTGACGAAGGGC
AGCAAAGAGACAAAGATCTCGGACGGGTCTTATTTTGGAG
AGATCTGCTTGCTGACTCGAGGCAGAAGAACGGCCAGTGT
GAGAGCGGACACATATTGCCGTCTGTACTCGCTCTCTGTG
GACCATTTTAACGAGGTGTTGGAGGAGTACCCCATGATGC
GACGAGCATTTGAGACCGTAGCCCTCGATCGCCTTGACCG
CATAGGAAAGAGGAACTCTGTACTCCAGCACAAAGTCCAA
CGGGATCTTAATTCTGGAGTTTTGAACTACCAAGAAAATG
AGATCATCCAGCAGATCGTGCAGCATGACAGGGATATGGC
CCACTGTGCACACCTCATGCAGACACCTCCCCCACCTCCT
CATCCAGCACCGACTCCATCCTCCCACACCCCTGTCATAT
GGGCACCTCTTATTCAGGCTCCTCTGCAAGCTGCTGCAGC
CACTACTTCAGTTGCCATCGCCCTGACTCGTCACCCCCAT
TTGCCCCACACCCTCTTCCGACCTCCTGTTCCTCGGCTTG
GCTCACTGAAAGACCAGCCAGGCTATTTTAAAAGGTTTCC
AACTGCACTTTCGGGTGCTGATACATTTGGTGGCTCCTCA
TCAACCAGCTCGCAGTTCAGCTCTTGTATAGAAACCCCAA
TTCTGGACACACTCAGGGCCGAGAGATCATCTACCTCCAC
ACCGCCACCATCCTCCAGCTCTCTGCCATCCACCATAACA
ACAACTGTCACCACTACCACTTCAAGCATCACAGAGTCTT
CCGTCTACCACCATAGACCCATTATCTCTCATGGATCCAA
AGACTTTAGCGTTGCCCAACTTCATTCTCAACCGCAACTT
TCTCAGGCCTCTTTCTCAAGCATTGCTGCATCACTTCCTG
GATTCTTCCAACAAGGAGCAGCTGGAGGAGAGGCTGTTCA
TCTAGCGGTTCCCCCTGCATCCACCCTTACTCCTTTGATA
GCGCACTCTGTAAGTCCCATCCTGACCCAGCTACATGCAA
CTCATTCAAATCCTCAACCAACAAAACCAATTCAAGACTT
AAATAAAGCTGGAAGGACAGCCCCCCAATCTCCAGTAACA
GAGTCCCCAGTCCACTCCAAGAGCATTCTTGAACAAGTAC
AGAGTCCAACAAGTGTCCAGTCCCAGCATCCTCAGATTGG
TATACAGCCGGATGTTCTTTCCCAGCTTGCTCAAGAACCA
TCTGCTCTTGCTTCCCTTGCACAATATGGATCTGGAAATG
CGTCCCCATGTAGCACACCTTCAGCTTGGAGCCCCACGTG
CCAGAGTCCAACAGCAGAGAAAATGAGAATGTCAGCGCAT
AGCCAACCTTCTAGCATCTCTGGATCCCAAACGTCACTAC
TGACCCCTCAGACACTCTTTCCACCACCACCTCAACCAAG
AGAAAGGGGTGGATCTCTAGTTGATCTACCTTCACAAGAC
TTAAGCACCCTTTCCATGTCCCTTCCTATTCCTGGACTAG
CCGAAAAATCCAGGGCTGTGGGAAGAGGACCACAACCACC
AGACTTATCTCATCACCGAGGATCCACTTCAGGTTACTCA
CCACTCCCATCCCCCCCACCCCTTGTGAATCCATTTAGCT
CAATACCTGGTCATGTTGTCTTATCGAGACAAACTTCCAA
GTTGTCCATAACTCAGACTGGGTCCTCAGGTGGATCACCA
GCCCATGGGTCAAGTGACAGGTCCACCCCTGGGACACCAA
GCTTGCACCCCAAACTCCCATCAAACTTGTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations