Community Action Needed: Please respond to the NIH RFI
Transcript

bambia-201

ID
ZDB-TSCRIPT-110325-815
Name
bambia-201
Previous Names
  • bambia-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050807 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050807|OTTDARG00000035675|ZDB-GENE-010416-1 bambia|OTTDARP00000039892 bambia-001 LG_ BX005058.3 Danio rerio protein_coding KNOWN, 1569 bp
TCCGATCAGTGATCCGCTGCTTCGCGATCGGGGATAGTTG
CCCTTGTGGAAACTTGTTTGTGTTATTTCACGAGTCCGTT
TGCGTTTTATATGTGTTTGTGTGTTTTTCATCGCATGGCG
GATTGGTTTGGTTACACACGGGGAATGTTTCTCCACTCGC
GCTAGTTTCGGATCCTCCGATGGAACAAGACGCGAGCCTT
TTCTGCGCCCGTTTGATTTTTGGATACAGTGTAGATCACA
GATCCCTGGGAATGCAGTAATAAATGTAGGACATATGTAA
CGAGTCCTCTCAAACCATTCGGAGGGTCTTGCCACGGGGT
ATCAAGACAAGGAAAAGCAGCCGTAAATGGATCGCCTGGT
TTCTCTGTGGTTTCAGCTGGAACTTTGTGCGATGGCTGTT
CTTCTCACGAAAGGAGAGATCAGGTGCTACTGTGACGCAC
CGCACTGCGTTGCCACCGGATACATGTGTAAATCAGAGCT
CAACGCTTGCTTTACTAAGGTCCTGGACCCTCTTAACACA
AACTCACCTTTAACACACGGCTGCGTGGATTCGCTTTTAA
ACTCTGCAGACGTGTGCTCTAGTAAAAATGTGGACATTTC
AAGTGGAAGCTCCTCTCCTGTGGAGTGCTGCCATGATGAT
ATGTGTAACTACAGGGGTTTGCATGACCTCACACACCCCA
GAGGGGACTCAACAGACCGATACCACAGCTCCAATCAGAA
CCTGATCACAAGGGTGCAAGAGTTAGCGTCTGCTAAAGAG
GTGTGGTTCCGGGCGGCGGTGATAGCGGTTCCCATCGCGG
GTGGGCTTATCCTGGTTCTGCTGATTATGCTGGCGTTGCG
AATGCTCCGTAGCGAAAACAAGCGTCTCCAGGCACAGCGC
CAGCAGATGCTTTCTCGCCTGCATTACAGCTTTCACGGAC
ACCACCATGCCAAGAAAGGCCACGTGGCTAAGTTGGACTT
GGAGTGTATGGTGCCGGTAACGGGACATGAGAACTGTTGT
CTGGGCTGCGATAAGCTGCGGCAGACGGATTTGTGCACTG
GAGGAGGAAGCGGGGGTGAGCGTCTCCTATCTCTGGTACA
CTGGGGGATGTACACGGGGCACGGAAAGCTGGAGTTCGTA
TGACTACTCAGAGCTTCTTTGTTAGGGCACAAAAGGGTAA
CTGTGTAGTTTGCTGTCGTAATGTTATTATTATCGGCGTG
TTATTTTATTGTCTCCAACGAGAGCAAAGACATTTCAAGG
ACACAATTCATTGTGTTTTCTCAAAAAAAGAGCACTTTAC
TTGAATTAGAATGGCCGGTCTCTGTGGGGGGCTGTGGTGA
ATATGAAAAGGGTGGAGCTTATGGACTGCAAGCCCCACCT
CCTTCCCTCTCTGGATCCTGGAATGACACTGAAGGATTCG
TTAAGACGGTCTTATTTTGCACATTTGTATAAAACGGACT
TGATGATTAAAGTTGTAAGGTCGCAGTCTGCGCCCTTTTT
TGAAGAATTTTACACTGACACCAGGGTACAGATAAGGTTT
GTTGTAGTCAAATTGTATGAATAAAAGATTCAATCTTGAC
TGTAACAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations