ZFIN ID: ZDB-TSCRIPT-110325-809
Transcript Name: lcmt1-002
Previous Names: lcmt1-002, lcmt1-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050788 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050788|OTTDARG00000035665|ZDB-GENE-040912-75 lcmt1|no_translation lcmt1-002 LG_none CR352324.11,FP236860.5 Danio rerio protein_coding KNOWN, 853 bp
GTAAACATGTGATTGTCAACCGGAGCGCTCGGTGCAGTTT
TGCTTCTGTTAAAAACCAGTATGATTAATTGAAATAAATG
TGCTTGAAGAAATATTTAAAGTATCAATTGATAATATTGT
CAATGACGCAATCTTACGCTGTTGCGTTCTTCGAAAGGAA
CCCGCTCAGTTTTGCCAACATTTAGGATTTTGTGTTCTCA
CGAATACAGTAACGTTATGTGTATTTAACGCTGCGTTTAT
GACTATAATTCCTATATTGCTTCAAAACTGCAAGTGTTCA
TGGCATCCAGACAATCATTTACAGATTCTGACACTGCTGA
CGAAGCGGTCAGAGCAACTTGCGACGATGCGTCCATATGC
AAAAGGTTTGCTACTAGTAAAGGTTACTGGACTGACCTCT
ACGTCCAGTATTTTGTGAGGCAAATAGGTGAACGGAAAGC
ACCTGAGATCAACAGAGGTTATTATGGACGTGTCAAAGGG
ATGAATCTCCTTCTTGACGACTTTCTCAAGAAGACACAAT
GTGACTGCCAGGTGGTTAATCTTGGGGCAGGACTGGATAC
TACTTTTTGGAGATTAAAGGATGAAAACATAATGCCAAAA
AAGTTCTTTGAAGTTGACTTCCCAATGATCGTTGCCAGAA
AAATACACAACATCAAGTAAGGTGTTTTTATTTTTATAAT
ATTTGTGCACGACTTTAGAATAAGGTAACATTGGTTAACA
ATTTTTAGTTAACTAGGAATTAATGTGACAGCTTTTAAGA
ACTTCAGTTCATGTTAATTCACAGCATCATTGTTTGATTT
TAAAAAGTGTTATTACTTGTTTAAATTAACAAACAATAGA
ATTCCTGAAAGCC

lcmt1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA lcmt1-201 (1)    Ensembl 2570
ncRNA lcmt1-002 853
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
lcmt1-002 Contained in:

Genome Resources: Vega_Trans:OTTDART00000050788 (1),  Ensembl_Trans:ENSDART00000149430 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH446070 (1) 879 nt
GenBank:CO814121 (1) 833 nt
CITATIONS (2)