ZFIN ID: ZDB-TSCRIPT-110325-2624
Transcript Name: lcmt1-201
Previous Names: lcmt1-001, lcmt1-002, ottdart00000050787

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050787 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050787|OTTDARG00000035665|ZDB-GENE-040912-75 lcmt1|OTTDARP00000047867 lcmt1-001 LG_none CR352324.11,FP236860.5 Danio rerio protein_coding KNOWN, 2570 bp
GGTCTTCTCGAAATGTATTATGGGAAAGTGTCGTCACCGG
AAGTAGATGTAAACATGTGATTGTCAACCGGAGCGCTCGG
TGCAGTTTTGCTTCTGTTAAAAACCAGTATGATTAATTGA
AATAAATGTGCTTGAAGAAATATTTAAAGTATCAATTGAT
AATATTGTCAATGACGCAATCTTACGCTGTTGCGTTCTTC
GAAAGGAACCCGCTCAGTTTTGCCAACATTTAGGATTTTG
TGTTCTCACGAATACAGTAACGTTATGTGTATTTAACGCT
GCGTTTATGACTATAATTCCTATATTGCTTCAAAACTGCA
AGTGTTCATGGCATCCAGACAATCATTTACAGATTCTGAC
ACTGCTGACGAAGCGGTCAGAGCAACTTGCGACGATGCGT
CCATATGCAAAAGGTTTGCTACTAGTAAAGGTTACTGGAC
TGACCTCTACGTCCAGTATTTTGTGAGGCAAATAGGTGAA
CGGAAAGCACCTGAGATCAACAGAGGTTATTATGGACGTG
TCAAAGGGATGAATCTCCTTCTTGACGACTTTCTCAAGAA
GACACAATGTGACTGCCAGGTGGTTAATCTTGGGGCAGGA
CTGGATACTACTTTTTGGAGATTAAAGGATGAAAACATAA
TGCCAAAAAAGTTCTTTGAAGTTGACTTCCCAATGATCGT
TGCCAGAAAAATACACAACATCAAGACAAAACCTCCACTA
TCGAAACCTCTGATTGAGACTCACTCCACTGATTCGCTTC
TTCTAGATGGTCATAGTTTGGACTCTGACAGATACTGTAT
TATCGGTGCAGATTTAAGAGACATCCCTACTTTAGAGGAC
AAGCTAAAAAAGTTCCAGATAAATCCAGAATTGCCCACGC
TCTTTCTGTCTGAATGTGTGCTGGTGTACATGAGCCCCGA
ACAGTCGTCCAGACTAGTGCACTGGATTGCAGAAACCTTT
CCCACGGCCATGTTCATTAACTATGAACAGGTGAACATGA
ACGATCGCTTTGGGCACATCATGATTGAGAATCTGCAGAG
ACGGCAGTGCAATCTGGCTGGAGTGGACCTCTGTCAGTCC
CTCGACTCTCAAAAGGAGCGCTTTTTGTCTTCAGGCTGGG
AAAGTGTAAACGCACTGGACATGATGACGGTCTACAGCAT
GCTTCCTCAGGAAGATGTAGCAAGAATTGAACGTCTAGAG
TTTTTAGATGAAAAGGAACTTCTCCAACAGCTTCTCCAAC
ACTACTGCATCTGCTGGGCTGTGAAAGATAAGCTCAATCT
AGGCCTGTCGCAAATTGGGTTTTAAACGGCAAGTGGGACT
CGGTTGTAAAAGTTTGAAACAACATGACCAGGAGTCAGAC
GACAGGAAAGGGAAGTCATTTATATCTTTATTTCCATTTT
TGACTACAATAAAAATGGAAACTACTGGAGTCAGCGTCTT
CTCTTCGCTTTTGAATGTCTCCTTATGTTTCCCAAGTGAT
TGACGTGTCTGACTTGAAGTGCCATATTCAAACTTCTATG
ATTTTTTTTTACCATAACTATTATTAAACCATTTTGGAAC
ATTTGTGGGATGCACATCAATGCTTATTTTGTAAGCTTTG
TGAGTGTAACTGGCCCTCTGTATTAATATTAATGAATTGT
GATGATTAATAAAGACAATTAAGAGTGTTAAATGAATGTT
ACGTGCATGTATTATTATTACACTTGAGAAAAGTTTTACT
AGAATACTGCAAAATAAGTGAGCAAATTCTAAAAAAAGCA
GCAGATATTATACACTCCAAAAACCCAAACGCTGGGTTAA
TAATTAGTATTTAAAATCATTAAAAAAACAAACCCAACAG
TTTGACCGAAAATTGTTTAAAACCACCAGCAATTAAGAGC
CTAGTTGCACCTCATCAATTATTGTAACAAGCATTTAGTT
AAATAAGCTATAGAGTTGATTGATAATTATCGGACACTCT
AAAATGCTGGGTTGTCATAATGTTCATATATGGAGAAACC
CACATATGGGTTCATTTCTTCCGATTTTTTTTAATGCCAA
ATACAGCATATTTTTAGATTGTATAGGACAGTGTTTTCCT
TTTTTTTTTCTTTTTTTTTTACATTTTAATACCTAGTTTT
CCCATTATCAAACCCAATATTTAATTGCCCACACAGTATT
TAGGATATTTTGTTATAGTGAAAGATCAGTACATTATCAT
TTACATTTTATTAACAAAAACTTAGGCCCCTAGTTAGGGC
CCTACTTAGTTTGTAGCTTCAGGTGTAGTTATCATGTTCA
CATTGTGCGCCATGTTGTTGAAATAGCAAATGCATTTGGT
CCCATTTGTGCTGGCATGAGTGTGTTAGGGCGCATTCTTG
GTGTTTTTCTATTTTGAGGCAACTAAAACAAACTTTGCCA
TTGGTCATCTAAAAGTGTTAGTGATTGGGGGGGGGTCCAA
ATTCACATAAATGTTGCTTATTACACACACAGGGATGTGC
TGCAGCAAATATTTTTATATATGAAAAAAATATAAGAATT
GCAATGTAAAATATTATTGTCTACATAAATATAAATAAAT
TGCTACCTCT

lcmt1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA lcmt1-201 2570
ncRNA lcmt1-002 (1)    Ensembl 853
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
lcmt1-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000050787 (1),  Ensembl_Trans:ENSDART00000077936 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC078431 (1) 2560 nt
GenBank:EH537158 (1) 966 nt
GenBank:EH475531 (1) 875 nt
GenBank:CK400277 (1) 841 nt
CITATIONS (2)