Transcript

chsy1-201

ID
ZDB-TSCRIPT-110325-778
Name
chsy1-201
Previous Names
  • chsy1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050615 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050615|OTTDARG00000035559|ZDB-GENE-030131-3127 chsy1|OTTDARP00000039743 chsy1-001 LG_none CU856378.10,CU457792.5,FO904922.1 Danio rerio protein_coding KNOWN, 3921 bp
CGAGAATGAGGATGCAGCCGCACTTCTTTCCGCAACAAAC
CGTTAATTGCTCCTGACTACCCACCGACTCGGGCTCGAAA
TCACGGAGATACCTTTACGAACCCCGTCATGGCTCTTCCG
GAGCGGATAGTGTGTGATTAGATGGCAGCGGTTGGTGATT
TATGGGGACCGGAGCGGTGACCATGCTCGGACCCAAACCC
AGCGTTGTGGACGGGACTGCAGCAGCAGCAACGGGCGGCG
TTTAATAAACAAAACTCTGACAAATTAAAGCGACTAGTAG
CTGAAATGGCAGGAAGGAGTCGCAGATCTTGGTTTAGCGT
GTTGCTGGGGCTGGTGGTCGGGTTCACACTGGCGTCCAGG
CTCATCCTGCCCCGGGCCAGCGAGCTGAAGAAAGCGGGTC
AGAAGCGGCGGGCGAGCGGCGGCGGCGCGGGAGGCTGCGG
AGGCGGCGGAGGGATGATGATGATGATGAAGAAGGAGTAC
GGAGGGGTCTTGATGCCCGGTACCGAGAAGCCCTCAGTGC
CCCAGTCTAGCAGCTTTCTGTTTGTGGGCGTCATGACCGC
GCAGAAGTACCTGAATAACCGCGCCGTGGCAGCATATAGG
ACCTGGGCCAAGACCATCCCGGGCAAGGTGGAGTTTTTCT
CCAGTGAAGGTTCTGACACCACCATCCCCATCCCCATTGT
GGCTCTGCAGAACGTGGATGACTCGTACCCTCCGCAGAAG
AAGTCCTTCATGATGCTCAAATACATGCATGACCACTATT
TGGACCAGTTCGAGTGGTTCATGCGAGCCGACGACGACGT
CTACATCAAAAGCGAAAAGCTGGAGAGTTTCCTAAGGAGT
CTCAACAGCAGCGAGGCCATCTTTCTGGGCCAGACGGGCA
TGGGAGCCCGCGACGAACTGGGCAAACTGGCGCTGGAGCC
GGGGGAGAACTTCTGCATGGGCGGCCCTGGTGTTATCATG
AGCCGCGAGGTGCTGCGCAGGATGGTTCCCCACATCCGCC
AGTGCCTGCAGGAGATGTACACCACCCATGAGGACGTGGA
GGTGGGCCGCTGCGTGCGCAGATTCGCCGGAGTGCAGTGC
GTCTGGTCCTATGAGATGCAGCAGCTGTTCTATGAGAATT
ACGAGCCAAACAAGAAGGGCTACATCCGTGATCTCCACAA
CAGTAAGATCCACAGAGCCATAACCCTTCACCCCAACAAG
AACCCACCTTACCAGTATCGGTTGCACAGCTACATGTTGA
GCCGGAAGATTGCAGAGCTGCGCCACCGCACCATTCAGCT
CCATCGTGAGATTGTGCAAATGAGCCGCTACAGCAACACC
GAGGTGCACAGGGAAGACCTTCAACTGGGCATGCCTCCAT
CCTTCATGCGCTTTCATCCCCACCAACGTGAGGAGGTGCT
GGAATGGGAATTCCTCACGGGAAAGTACATTTTCTCATCC
TCAGATGGACAGCCTCCCCGTCGAGGCATTGACTCCTCGC
AGAAGATGGCGCTGGACGACATCATCATGCAAGTTATGGA
GATGATTAACGCCAATGCCAAGACACGCGGAAGAGTCATT
GACTTCAAAGAGATCCAATATGGCTACCGAAGGGTCAACC
CTATGTATGGTGCAGAGTACGTACTGGATCTGCTGCTGCT
CTACAAGAAGCACAAGGGGAAGACTATGACAGTGCCCGTA
AGGAGGCATGCGTATCTTCAGCAGACCTTCAGCAAGATCC
AGTTCTTGGAAGAAGAAGAGATGGACGCTCGAGTCCTGGC
TGCCAGGATCAACCAAGACTCCGACTCGCTGTCTTTCTTG
TCCAACTCCCTCAAGATGCTCGTCCCGTTCAAGTTGAGCA
GCCCAGGCATCGAACAACACGAACCCAAAGAGAAGAAGAT
CAACATCCTTGTGCCGCTGGCCGGACGCTACGAGATTTTT
CTGCGCTTCATGGCCAACTTCGAGAAGATCTGCCTCATTC
CCAACCAGAATGTCAAGCTTCTGATTCTGCTTTTCAGCAC
GGACAACAACACTGAGCGCATCAAGCAAATCGAGCTCATG
AGGGAGTATCGCATGAAGTACCCCAAAGCCGACATGGAGA
TCAAACCGGTTTCCGGACCATTCTCCCGTGCTCTGGCCCT
GGAGGTCGGCTCGGCCCACTTTACCAATGATTCTTTACTC
TTCTACTGTGACGTGGACTTACTGTTTACGCCTGACTTCT
TGACTAGATGTCGTGGGAATACCATACTTGGGGAACAGAC
ATACTTTCCTATTATTTTCAGCCAGTATGACCCAAAGGTT
GTCTACGCAGGGAAGGTGCCCAGCGACAACCACTACGTGT
TCACATCCAAAACAGGCCTGTGGAGACACTATGGTTTTGG
TATTGTCTGCGTCTACAAAGGAGACCTGGTCAAAGCTGGT
GGTTTTGACGTCTCCATCCAAGGTTGGGGACTGGAGGACG
TTGACCTTTTCAACAAGTTTGTCCAATCCGGGATCAAGCT
GTTCCGCAGTACGGATACCGGCATCGTTCACGTGCATCAC
CCTGTGGTTTGCGACCCCAATCTTGATCCCAAGCAGTACA
AAATGTGCCTGGGATCCAAAGCATCCTCGCACGGCTCCAC
GCAGCAACTCGCAGAGCTATGGTTGGAGAAAAACAACCAC
AGCTTCCGAAAGATCTCGAACTCCAATAATGAATCAATGA
GGACAGAATAGACCTGGCAAGTGCACATTGTCCATCCGTC
TTCCTCTTAATGGTGTTTTTTAAAACTACCTTATTTATTT
TTTACAGGAAAAAGACTTCTGTGGATATATTTTGAAATAA
TAACTGGTTTTGTAAACTGTACAGGAGCAGGTCGTCACCT
TCAGACTTGATCTTTTTTAAGTAGCGTTTCAAATAACACA
ACAGTGACTTAAAGAGGACGATCTATTTTACAAATCCAAT
ACTGAGCGTTATATTTATGGCACCTCAAAAACAGACTGCT
GTGGACCTCGCCAGAAAAAAAATGCTTTGAAATGGAGTCG
AAGAGGGAGTTTGGACACGGACTTGTGTGGTGTCTGGCAA
AATGGTAAATGTTTATTTGTGAATGTTTACAGAGAGCGAT
GAACAAGTGATTCATTCTTGGTGAAGGGGATCTTTAGAAT
AACAATCTTAATTCTGACAATTAAGGGCCATTGATCAACA
GCTTCTTTTCGGTTCGTTTTTTCCAGTTTACTTGTCTGGA
GTTGGGAGGGGGATCCATAATAACACTGTTTTGTTTTTAT
CGCTTTTGATTTATTGTTTTTATTGACTTCTGTGAATGAA
ACTGCTGGCTGTTGATCTCTCCTACTCATTCCCACTGTCT
AATTTATTGAGCGTTCAGTCTTCGGGGCTGAGGTTGTGTA
TATTAGAGATTGTATAACCGTTTCAGTCATGGATAGTGTT
TTTGTTCCCTCTCTTGATCTTGAATTACTTTAATTACCAA
AGACTTTCTTTCTTTTTTTTTTTTGCACAGTTGCTGTAGG
TGATATTTGTTCAAGAGTGCTTGTTTTTGTGTGTGCGTGC
GTGTATGAGTCCAAATGCAAGACAGTAGAGCAGGAAAAAA
CATGTAATGTACTGTAGGATGGAGGTACCGATGACTATTC
AACATGGCCCTATGAAAGTATGCCGACAACAAGCCACTTA
AAGAGATTTTCTCATTTCATATGATCAGATTTCATTTACT
CCTCTTGGTTATTTAAATTTTTTGATTCAGTTGGCCTTTC
TCCTGTGATTGAGCCATGCACCCTGTGGGGACAACGGCCG
TAACGCGGCCTCGCCTTCAGATTCGAGGACGATCTCCCAC
AGTAGTCTCTCTTTCTGTTGTCTTTTGTTTTTCTCTGGGG
CGTTTTCATACTTCAGTTCTTTGTTAGCCCCCATACAACT
GGGACAAAGTTTTATATTTAATAAAATGGAAAATGAAAAA
G

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations