Transcript

apc-201

ID
ZDB-TSCRIPT-110325-772
Name
apc-201
Previous Names
  • apc-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050578 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050578|OTTDARG00000035536|ZDB-GENE-031112-7 apc|OTTDARP00000039711 apc-001 LG_none CU915637.3,CU861476.9 Danio rerio protein_coding KNOWN, 9187 bp
ATGGCTGCAGCGTCTTATGATCAGCTGCTGAAGCAAGTGG
AGGCACTGAAGATGGAGAACTCCAACCTGAGACAAGAGCT
CGAGGACAACTCCAACCACCTCAACAAACTGGAGACGGAG
GCCTCTAATATGAAGGAGGTTTTGAAGCAACTGCAAGGAA
GCATTGACGAGGACTCCAAAGATTCACAAGGACAGATCGA
GTTTTTGGAGAGAATTAAAGAAATGAGTCTTGACCCGAGC
GGTTTCTCTGGGGTGAAGCTGAGGTCTAAAGCGTCTCTGC
AGGGCTCAGCAGACAGCAGCCCCAGCCCCAGCCCCGTCAG
CTCTTGCCCTAGGAGAGGGGCGTCCAGCGGGGGCAGAGAC
AGCGCTGGATATCTGGAGGAGCTGGAGAAAGAACGGTCTC
TGTTGGTGGCAGAACTAGAGAAGGAAGAAAAGGAGAAGGA
CTGGTATTATGCCCAGCTGCAAAACCTCACGAAAAGGATC
GACAGTCTGCCACTGACGGAGAATTTTTCTCTCCAGACTG
ATATGACTCGCAGGCAGCTGGAATACGAGGCCCGGCAGAT
CAGAGCCGCGATGGAGGATCAGCTGGGCACGTGTCAGGAC
ATGGAGAAGCGCGCACAGGGTCGTGTCGCTCGGATTCAAC
AGATAGAAAAAGACATGCTGAGGATTCGGACACGTTTACA
GGCCCAGTCCGCTGAGTCAGAGGTCAAGCATGAGCCGCTG
AGTCAGACTGAAGGATCTCATGCAGCAGGAGACGCAGGCG
CCGCCGCTGCTGCTTCTGTATGCTCGCAGGGCTCAGCTTC
TCGTGTGGATCATGACTCGGCCAGTGAGATGAGCAGTGCG
GGCAGTTACTCTGTTCCACGCCGACTGACCAGCCATCTGG
GCACGAAGGTGGAAATGGTGTACTCTCTGCTGTCCATGCT
GGGCACTCATGATAAAGACGACATGTCCCGAACACTGCTG
GCCATGTCCAGCTCTCAGGACAGCTGTATCGCCATGCGTC
AGTCGGGCTGCCTGCCCCTGCTCATCCAGCTCCTGCACGG
AAACGACAAGGACTCTGTGCTGCTGGGAAACTCACGTGGC
AGTAAAGAGGCTCGCGCCCGAGCCAGCGCCGCCCTGCACA
ACATCATTCACTCACAGCCGGACGACAAGCGCGGACGCAG
AGAGATCCGCGTACTGCACCTGCTGGAGCAGATCCGGGCC
TACTGCGAGACCTGCTGGGAGTGGCAGGAGAGCCACGAGC
GAGGTGTGGACCAGGACAAAAACCCCATGCCTTCGCCGGT
GGAGCATCAGATTTGCCCGGCGGTTTGTGTCCTCATGAAG
CTTTCCTTTGATGAAGAGCACAGACACGCCATGAACGAGC
TTGGCGGTCTTCAGGCGATCGGGGAGCTGCTGCAGGTGGA
CTGCGAGATTTACGGTCTTACCAATGATCACTACAGTGTT
ACACTAAGACGATATGCTGGGATGGCTCTGACTAATCTGA
CCTTTGGAGATGTTGCTAACAAGGCAACACTTTGCTCAAT
GAAGGGTTGCATGAGGGCCATGGTGGCTCAACTGAAGTCA
GAAAGCGAGGACCTACAGCAGGTAATTGCCAGTGTTTTGC
GGAACCTCTCATGGCGAGCTGATGTGAACAGTAAGAAGAT
TTTGCGAGAAGTAGGCAGTGTGCGGGCTCTGATGGAGTGT
GCCTTAGAGGTGCAGAAGGAGTCCACATTAAAAAGTGTCC
TGAGTGCCCTTTGGAACTTGTCGGCTCACTGCACTGAAAA
CAAAGCTGATATCTGCACCGTTCCCGGAGCTTTGGCGTTT
TTAGTCAGCACTTTAACCTACCGAAGCCAAACCAACACCC
TTGCCATAATCGAAAGTGGAGGTGGCATTCTGAGAAACGT
GTCAAGCCTCATCGCCACAAACGAAGAGCACAGGCAAATA
TTGAGGGAAAACAGCTGTCTTCAGACTCTTCTTCAGCACC
TTAAATCACACAGTCTGACGATAGTGAGCAACGCCTGTGG
GACGCTGTGGAACCTCTCCGCTCGCAACGCAAAGGATCAG
GAGGCATTATGGGACATGGGTGCAGTCAGCATGCTGAAAA
ACCTCATTCACTCCAAGCACAAGATGATCGCTATGGGAAG
CGCTGCTGCTTTGAGAAACCTCATGGCAAATCGGCCTGCC
AAGTATAAGGATGCCAACATAATGTCTCCTGGGTCCAGTC
TGCCGTCCCTTCATGTAAGAAAACAGAAAGCACTAATTGA
AGAGCTAGATGCACAGCACCTCTCTGAAACCTTCGATAAC
ATCGATAACTTGAGTCCAAAAGCCTCTCATAGGGTCAAGC
CAAGACATAAACATAATGTCTACGGTGATTATGATGCCGT
CTGTCGATCAGATGGCTATAACCCCAATGGTGTTGGTGTT
CGCTCGCCTTACATGAACACTCCGGTGCTCTCAAGCCCGT
CCTCTAGAGACAACCGAGGAAATGCAGAAAGTGTCCGAGC
CGAGAGAGACCGAAGTCTCGATCGAGAGCGAAGGGGGTTC
CTTCCAGACGGTGAGGCTGCCAAACGAATGATGCAGATTC
CCACGAGCGCAGCTCAGATTGCAGTAGTTATGGAGGAAGT
ACAGAACATGCACTTGGGTATGGATGACAGGTCAGCAGGA
TCCACACCAGACCCTCACTCAGTGCAAGATGACATGATTC
GTCGTCAGACTGCTGTTCATGGTCACCAAAACATATACAG
CTATAGCAAAACAGACCCATCGGGCAGACCCTGCCCAATG
CCCAAACTGGAGTACAGAGCTTCTAATGACAGTCTGAATA
GTGTCAACAGCACTGACGGCTACGGGAAAAGAGGTCAAAT
GAAACCCTCAGTAGATTCCTATTCGGAGGACGATGAAGGC
AAATGTTGCGTCTACAGAAAATATCCTGCGGACCTTGCCC
ATAAGATACACAATGCAAATCACATGGAAGATGATAATGG
AGATCTGGACACACCTATTAACTACAGTTTGAAGTATTCT
GATGAACAGCTCAACTCTGGTCGACAAAGCCCGAGCCAGA
ATGAAAGGTGGGCAAGGCCTAAGCTCCTCGATGATGAAAT
GAAACGGCCAGATCAGAAACCACCGCGATCACAAAGCCCA
GGATACCCTATGTACACTGAAGGCAGCAGCGAGGGAGAGG
ATAAACCCAAAAAGTACCAACCCAGGTTTGTTCAACAGGA
CCTGCCTGCATTTCGGTCAAGGGGCTCCAATGAGCAAATT
AGTAGCGGGTCAAGTCATGGACTTAACAAGAAGATCTCTC
AAACCATCTGTAGTGTCGATGACTATGCAGATGACAAACC
AACAAACTACAGCGAGCGCTACTCAGAAGAAGAACAGCTC
GAGGAACAAACTCCCAGCTACAGCATGAAATACACTGAGG
ATCATCATGTAGAGCAGCCTATTGATTACAGTTTGAAGTA
CTCGGAAGCTCCTTCCAAGAAGGGCATGTTTAGTCATTCA
AAGACGTCTTCTGCACAGAGTTCTGCCAAAGAACATTTAA
GCCAGGATAGTTCTTCTTCTGTGGCATCTTTAAAGAATCA
GGGCAGGCAAAAGCAGCTCCACCCTTCATCTGCTCAAAGC
AGATCCGGACCAACAAGAGCAGTTCAAAAGAACCCAACAT
GCAAGGCTCCCACAATAAATCAAGAAACTTTACAGACCTA
TTGTGTGGAAGATACTCCCATTTGTTTTTCACGTGGTAGC
TCTTTATCGTCGTTGTCTTCAGAGGAGGATGAAATGGAGA
GCTGTAAGCGTAATGTCAACTCGGCCAGTAACTACCCAAC
TTTACCTATATCAGAAAAACAATCCACTAATAATGTTGCA
GCTGACCAACGCACATCTGAGAGCCAATCATCAGTCCATT
ATGTTCGCGCCAAGCCTCCACGACATCATTTAGGACATGG
TGATGGTTCCAGGCATCATAAAACGGTGGAGTTTTCATCA
GGGGCTAAATCACCTTCTAAAAGTGGTGCCCAAACACCTA
AAAGTCCCCCTGAGCATTATGTACAGGAGACTCCTCTAAT
GTTCAGCAGATGCACTTCAGTCAGCTCCCTTGACAGTTTT
GAGAGTCATTCCATTGCCAGTTCTGTGCAGAGTGAGCCAT
GCAGTGGGATGGTCAGTGGCATCATCAGTCCGAGTGACTT
ACCTGATAGTCCTGGACAAACAATGCCTCCAAGTCGCAGC
AAGACACCACCACCTCCACCTCCGCGGTCCACGTCAGTAA
AACAGAAAGTTACAGTGCCACCCCACACTGAAAAACATGA
TTTGGCGCCAAGACATGCAGTTGTAAGTGCTGCCGTGCAA
AAAGTGCAAGTTTTGCCAGATAATGATACTCTTCTACATT
TTGCCACAGAAAGCACTCCAGATGGTTTCTCCTGCGCCTC
GAGCCTTAGTGCGCTAAGTTTAGATGAACCCTTTATTCAA
AAAGATGTTGAGCTGAAGATAATGCCTCCTGTTCATGAGG
ACGACCATAGTATTGAGGCAGAGCCTGAGATGGAAGATAT
GCATGAGCCCAAAGTTCAGGAGAAATCACCGGCAACATCT
GAAGCTGCAAAAGACATCTTGGATGACTCGGATGATGATG
ACGACACAGAAATTCTGAATGCTTGTATTAACTCAGCAAT
GCCAACAAAATCATCAAGAAAACCGAAAAAGCAGTCGACA
TCAAGGATACCACCACCCGTGGCTTGCAAACCGAGTCAGC
TCCCTGTTTATAAATTATTGCCACCACAAAACAGAGGGCA
ACCGCAGAAGCATGTGGCCCTAGCACACGGTGAGGACATG
CCCCGTGTGTACTGTGTTGAGGGAACACCCATTAACTTCT
CCACAGCAACATCTCTCAGTGACCTCACAATTGATTCTCC
TCCGAACGAGTTGGCAGGTATGGAAAGTTCAGCTCCCCAT
GTAGAAGCATCTGGTCAAAGACGGGACACTCTGCCTGAAG
GGAAAAGCGCAGAGGCTAAAGAGACCGGTTTATCACCTCC
CATGCAGTCTGCTCTTGCTGAGAATGAAGGAGATGATATT
CTTGCTGAGTGTATCAATTCAGCAATGCCAAAAAGCAAAA
TACACAAGCCGTTTAGAGTGCAGAAGATGCCTGATCAGGC
TCAGCATCCATCCACTGCCACTGGCAGTCTAGTTCAGCAG
GACCTGGAAAAGAAAAAGCCAACATCTCCTGTAAAACCTA
TGCCACAAAGTAGTGAATATAGAGCAAGGATGCTCAAACG
GCCAGAAGCTAATAATAGCTTGGCAGATCCAGCAACATAT
CCAGATAAAAATAAAGAAACCAGAAAGCAAGAACCCAAAG
TAGTCATTAGAGACTTTGCTGATAAGCCATCTAATGCTGA
GGAGAGGACACGTCCCGGATTTGCCTTCGATTCTCCACAT
CATTACACACCAATTGAGGGGACACCTTATTGCTTCTCTC
GCAATGATTCACTGAGTTCACTTGACTTTGAGGATGAGGA
TCTTGACTTTTCTAAGGAAAAAGCTGTGCTGCGAAAAGAT
AAGGAGCAGAGAAAAGTTCCCCTTCTGAAGTGCAGTGTGG
AACAGCCAGCAAATACCAACATGGTATCGACATTTCAGAC
AGCTCCAACAAAACCTCTTCAAAAAACAGTTTTTCCACAA
GCACCCAAAGAAAATACTGTTGTGGTGTGTGATGAAAAGC
AAAAGTTTTCCATTGAAGACACTCCTGTATGTTTTTCAAG
AAACTCCTCACTCAGCTCACTAAGCGACATTGACCAAGAA
AACAACAATAAAGATTGCTCTCACAAAGATGATGTAACTC
AAATGGAGGCACCTAGGCCACAAGCGTCTGGTTATGCACC
AAAAGCCTTCCACGTGGAGGACACCCCTGTGTGCTTCTCT
AGAAATAGTTCCCTGAGCTCTCTCAGTATTGATTCTGAAG
ATGACCTTCTCCAAGAATGCATCAGTTCTGCAATGCCAAA
GAAAAAGAAACAGACACCAAGGAGTAAGACAGAGGAATCC
GGGGTAAAGGAAGAAAAGAGCATGATGGCTGATGGTATTT
TATCAGAGGAACCAGATCTTATATTAGATCTCACAGACAC
ACATAGTCCTATTTCAGAGCAAGCCTTATCACCAGACTCT
GAATCATTTGATTGGAAAGCCATTCAGGAAGGTGCTAACT
CTATAGTCAGCAGTCTACATCAGGCTGCAGCGAGTCTCTC
GAGACAAGGATCCTCTGATTCAGACTCTATTCTTTCTCTC
AAATCTGGAATCTCCATTGGGTCGCCTTTCCACCTGCCTT
TAAATCAAGATGATAAGCCTGCCCCAAACAAAGGGCCAAG
AATACTGAAACCTGGTGAGAAAAGCAGCATAGAAGCCAAA
AAGAAGGAGGAAGAGACTGCAAAGAGTCTGAAAGGAGGAA
AGAAAGTGTATAAAAGTCTAATAACAGGAAAGCCCCGACC
CAGTCTTGAAAGCATGGCCTCTCAGCACAGACAAGCTCAA
GCTCCTGTGATCTCTCGAGGGAGGACAATGGTTCACGTTC
CTGGCGTCCGGAGCAGCTCCCCTAGTACCAGTCCGGTCCC
CAAAAAGCCCCCTCCACGTGGCCAAATGTCAAAACCCCCA
TCTCAAGCGCCAGGTGCTGGAAGCTCTCCAAGAACCATGA
AAGTCCCACCAAGTTCTGAGCCTAGTCCTGCATCTGGTCC
ACCATCTTCCCAAGGAGGGTCAAGTAAAGCTTCCTCTCGC
TCTGGGTCTCGAGACTCCACACCCTCTAGACCAGTTCAGC
AATCTCTGACAAGGCCCATGCAGTCTCCTGGTCGTGCCTC
TGTTTCACCTGGTAGGAATGGCTTGAGTCCTTCGAACAAA
TTATCTCAGTTGCCTCAGTTGCCGCGCACTGCCTCTCCTA
GTGCATCTTCAACTAAATCTTCAGGATCTGGTCGCATGGC
TTACACTTCTCCTGGAAGGCAGTTGGTACAACCAACGCCA
ACAAAGCAGAGTGGTTTGCCAAGAAGTACAAGTGGAATTC
CTAGAAGTGAATCTGCCTCAAAAATCCTAAACCAGTGTGG
TCCTTCAAAGAAGGCAGAATTGTCTAGAATGTCTTCAACA
AAGTCTAGTGGTAGCGAGTCCGACCGCTCGGAGAAGCCTG
GACTTGTTCGTCAATCAACATTTATCAAAGAAGCACCTAG
TCCAACGTTAAAAAGAAAATTAGAGGAATCTGCATCATTC
GAGTCCTTATCTCCTTCATCTACAAGCCAGTCACAGACTC
CAGTATCTAGTCCTTCCTTGCCAGATATGTCACTTAGTCT
ACCCTATCAGGGAAGTGGTTGGACAAAGGCCCCTCAGAGT
CAGAACTCTGCAGAGAATGGTGACGGCAAGTCACTCAAAA
GGCATGACATTTCCCGATCCCATTCGGAAAGTCCTTCCAG
GCTCCCAATCAACAGGACAGGCACATGGAAAAGGGAGCAC
AGCAAACATTCATCTTCTCTCCCAAGAGTTGGCACTTGGA
AAAGAACCGGCAGCAGCTCTTCAATTCTCTCCGCGTCTTC
TGAATCCAGTGAAAAAGGGAGAAGTGAGGATGAGCGACAA
CCAACTAACCCACCTCAAAAATCAGGTAAAGAGGGGGGCC
TGGAGCGCAAAGGAACATGGAGAAAAGCGAAGGGAAGTGA
AACCTCCTATGCACCCATGTCATTAGACTTGCAAGATCAA
ACCGGCGATGCCATGTCCAAATCAGAAGATGTCTGGGTGA
GAATTGAAGACTGTCCTATAAACAATCCACGGTCAAGTAA
ATCGCCCACCGCCTCCACACCTCCTGTTATTGACAGCCTC
CCAATCAAAGGGCTTGCCTGCGACAGGGACTCAAGTGAAT
CACACTCGAAACTAATGAGTGAGAATGCTGCTATGAGCCA
CTTGGGTTCAGAAACAAACCTGAATTTACTCAGGAGTAGC
GAGTCACTTGACAAAAAAGTCACTGACATCAAGCCTGCAC
CAAGTAATCCAAACATCGGCCCAGAGCTCCATGAGTTCCC
GGTTTCTGAACGCACACCATTTAGCTCAACTAACTCCAGC
AAACACAGCTCCCCCAGTGGTGCAGTAGCTGCCAGGGTCA
GTCCTTTTAATTACACACCAAGCCCTAGAAAGAGTAGCGC
TGACGGCTCGACTCCTAGACCATCTCAGATCCCAACTCCG
ATTTCAAGCAATGCAAAAAAACGAGACACTAAAGGAGACA
CCACTGAAAGTGGGTCCTACATCGTAACCTCTGTCTAAGT
TTGGACTTGCCCAAAAAACTTTAGGACACACTTATTACAC
ACTCTGGCTTTGTGGAGACAGAGCGCCACTTTGGCATAGA
CGTTCTTGTTGTTGCACTCTGTGTTAGACAACTTATTCTT
GCTGGCTGATTGCTGTTCAAGCTAATGTTGGTTTCAAATC
CCGGGAGGCGTCTGAAAGCGAACATTTTGACAATTTGTAC
TGTACAGATTTGATTATGTATATAGTTAATTTAACCACAC
ATCAGGATCCTGTATTTAGCTCGTCTTTACAAGAATAACG
ACTATTGGTGGATTATGCTGTTCAAGTTCTGGTGGAATTC
AATATTAATGCGTTTGATTTATTTTATTTTATTTTTTAGA
ACAAACTGTAAACCTGTATTAATTGACATGATAAACTCAT
TCTTACTGTTGCATATTGTATTTACATAATGGATTTCCTC
CTTGCATGAACCGATTCAGTGGTATAGTATTTCCTATAAA
GATCAACATGTCTGTGGACACATGACCTGTACTGATAGCT
GTAGTGTAACATTTTACACTTGTGTGTGTGCGCTTCTGAA
GGCAAGAAATAACCCGCAATACTGTTAAATGATGTTGATG
GTTGACATAGATTATATGAAAAAACATAGTTCCATTGCTC
TGCTGTTTGTGTATAGTTGTTGCCAGACGAGGCGGGTGTC
TTTTCACTGAAACTATAGTCTCGGACGGACTGAAATGATG
TTTGAAAATTAAATTATTCCTGTAGGTTTTGGTGTTGGTA
CCTTTATGAAAAGCTCATTTGCTTCCCCTTAATTAAGCAC
ATATTTAGATTCAACTGTTTTGCCAAAACCACGGTGTAAA
TAATCACGTTTTATTTGAGGTTTTTAATTGTTATTTTTCT
CATGCAATAAAGTGGGCAGATCAATGTTTACAAAATATTT
CCAATAAAAAATATTAAATCTACATCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations