Transcript

ddx21-202

ID
ZDB-TSCRIPT-110325-761
Name
ddx21-202
Previous Names
  • ddx21-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050527 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050527|OTTDARG00000035499|ZDB-GENE-031113-10 ddx21|OTTDARP00000039667 ddx21-001 LG_ CU694274.5 Danio rerio protein_coding KNOWN, 422 bp
GAGAAGTGGCAGGACAGCCGGCGCTGGACGCTCAGCACAG
CCACACAGCTGCCGGAGCTGGAGCAGAGTCTGCGGCCCAA
CTCGGGCTTCGGGAACAGCGGTGGGTTCGGGAACAGATCA
GGATTCGGGAATCGCTCTGGGAATCGTTCAGGATTCGGAA
ACCGTGGAGGACGAGGACGATCATCCGGCTTCAGGAGCTC
AGGACGCGGTGGAGGAGGAGGACAGAAACGCAGCTTCAGT
CGGGCCTTCAACTACTGACCCTGCACTCTCTGATGGTCTG
CAGACCGTCAACTTTTATTATTACCACAATTAATATTTGC
TCGCTCAGGGCGTCAGTATCCATTACATACACTGACTGCT
TTTACTGCAGTTGTGCTGTTTATACGAGGAGTCCCACTGA
TATTAAAGTGGCGTTAAAACCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations