Community Action Needed: Please respond to the NIH RFI
Transcript

disc1-202

ID
ZDB-TSCRIPT-110325-745
Name
disc1-202
Previous Names
  • disc1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050453 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050453|OTTDARG00000035454|ZDB-GENE-090122-1 disc1|OTTDARP00000039605 disc1-001 LG_ CU855775.13 Danio rerio protein_coding KNOWN, 3216 bp
GCGTCGCGTTTGGAGTTGAACTAAAGTAAAAAACTAAGTA
AATAACCAAGTAGTTTCGGGGATTTACCAGTGTTAAACCA
CCATGATGTTCGCAGGAATGGTCAGGGTGGAAAACACCTC
AAAAACGCTCAAAACTGACATAGACTCTCCATGTCACCGG
TGTGCTGTGAGGACAGGTGGTGTGAATCCTTCGGGAAACC
ACCGCAGGAGGAGCTTCAGACGGCCCGGATACATGCGGTC
TGAGCCGATTAACCAGCTGGACGTTGCAGAAACATCATGT
GATTCTGAACATCACAGAAGTCCTATTTCCAAGTCGCCTG
CTGTGGAGAACACTCAAAAGAGTGCTTCAGAATTACTTGG
CGAGAAATGGCTGACAGAGGGTTTCGAGAGAGACAACTCA
TCAAAGTCTTCAAATAAACACCATTTGCATGATGAGGAGG
ACAATTTACCAGTGCAATCACGTGATGTTTTCAATTCCAG
TTTCAGTTTCATTCAACAGTCGCTAGACACTAGCGATTTA
TTAGATGTAAACACATGCTATTCACCCAGAACTGAACACA
AACAATCTGAATCAGCGTCAGGGCACCAGCTGAAGTCTAA
AACTTCAAATTCAGGCTTTCTTAAACCTCCATCTGATTTA
ATGAATCACTTGAGCCAATCAGAAACCAGCATTGTTCAAA
TGAACCAATTAGAAACCAGAACTGTCCCGGTAAGCCAATC
AAAATCAAGCTTTTTAAAACCTCTGTCTGCTTTAATGAAT
CACTTAAGCCAATCGGAAACCACCAGTGTTCCAATCAACC
AATCAGAAACCAGCAGTGCCCCAAAAAGCCAATCAAACTC
AGGATTTTTAAAACCTCTGTCTGATTTAATGAAACACTTG
ACCCCACCAGAATCCAGCATTGTTTTAATGAACCAATCAG
AAACCATAACTATTCCAATGAACCAAACAAAAAACAGCAC
CATCCCAGTGAGCCAATCAAATGCAGACTTTTTAAATCCT
CCATCTGCTTTAATGAATCACTTGAACCAATCAGAAACTG
TGCTTATTCCAATGAACCAATCAGAAACCAGCTCTATCCC
AGTAAGCCAATCAAACTCAGGGTTTTTAAAACCTTCATCT
AATTTAATAAATCACTTAAGCCAATCAGAATCAGTCACTG
TTCCAATGAACCAATCAGAAACAAGCACGGTCTCATTAAG
CCAATCAGAACCTGATTTTTTTTCTTTGAGACATTTGCCT
TGTTCGATTGGTCAGTCGGCGCAGCAGAAAGGTCTGCTAT
TGGACCGAGAGCTGTGGTTGGTGGATCTGGACTTGCAGAC
CTCGTCCTCCATTATGTCTAAGTATACAAAAGAAAACATC
CAGGATTCGGATTCTGGCTCTCTGGACGCTGAAATCACGT
CTTCACACTCCATTGACTCTTCAGACTCGACTTCGTCTGG
ATATGAAAGCACCACACCGTCCTCAGATCAGAGTCAGGAT
GGTTTAATGAAGAAGTATGAGGATTTTCTGCAAGACTGTC
TGCAAAACAATCGCACAAACACCAAGATCGAGTCCATAAT
GATGAAGCTTCAGAGATTACAGCACAAAGCCATTCTGGAT
GATGATTATGACACAGCTGAGCGTTTTGGTAAGAAACTGG
AGGAACTGAGAAGAGAAAGAGCGACACTTAAGCCTGGACT
TCCATCCAGACACCCTGAAGTCACTGGATATCTGGAGCGG
CTCAGAACAGCAGTGAACAGCGCCATCCACAGGACAGACT
CAGACTGCAGCACTGGTGACCCGAGTGAAGATCAGAGGTC
CTGCATCTCTCAGAGTCGAGCTCAAACACGAGAGACGCTG
TTAGAGGAGAAACAGAGGATTCAGAAGGAGATGTGTGATG
TTCAGCGGCGGCTGCGGGATCTGCAGGAGCGCAGCAGGGC
TCTGGAGCTTCAGCTGGAGCTGCAGGAGATGCAGGGACCC
GTCCTCAGGGCCGCAGACTCTCCTCATCTGCATCTGACGG
CTCGAGCGCTGGAGGATCTGCTCACGTCTGAACATCGCCA
GCGCATCAGCGTTTCTCCACCAGCACACATCCGCAGGCTT
GAAGAGCAGGAGCGAGTGCTGAGTTTGTCCATCAGAGAAG
CAGAGACTAAAGTGTTGTTGAATCAGAGGTTGTGCTTCAG
TCTGAGGCAGAAGGTCAGCGAGAGCGAAACGCAGCTGCTG
GCGCTTCATGAAGCCAAACTCACAGCCGTATCAGGAAATG
ATTTCAGCAGTGCTAAAGAGCTTAAGGCGGAGATCAGGAG
TGTGTACAGAGAGAGGGATCGTCTGGAGCTCCTGCATAGA
AAGCTGCAGACTCTGAGCACAGGAAGTGGACTCGACCTGA
GCCGCATGAAGGAGAAACACAAGCACATCAAGCTGGAGCT
GCAGAACGGAGAAGCTCAGTATGAGCGCAGTTTGAAGGAA
AACACTGTGAAGTACATTGAGCTTCTGGAGGACAAACTTC
ACAGCTGTGGAAGTGCAGCGCTGGAACATGTTTTGGAGGC
TGATTTGGAGGCCTGTCATCTCCTCCTGAAAGGCCTGGAT
CAGAGAAACCTCAGCCTCTCCCAGACGGAGGATCTTCCCT
CAGGATCCGCATCTGCTTCAGATGTCCTGCAGTTCACTAA
AGATGAAGAGGACTGCGCCATGTTGACTGCTTTAGGGGGA
CGCTGGTGTCCCGAAGCTGATCTACAGCACTCTCAGTTCA
CAAAGAAATTGGAGGAGTTTCTCTTCTGTTTGGAGGACGA
GGCTCCAGAGAATCTGTGTGGAGAAACAACAGAGCTGACG
GACCGCTGTGAACTCATCAGTTACCGACTGCATTACCTGG
AAGAGCAGCTTCAGACAGCCATAGACAACAATGACAAGGA
GCTCACTCTCTCTCTGGAGAGGGAGGTCCTGGAGCTGAAG
TCTGCTCTTCAGGCGATGCTGTCTCAGCTGAAGGAGGAAG
ATGAGGATGAAGAAGACGAAGAGAAATACTGTGATGTAGA
AGAAGAACAGGTTGAAGATGAAGACCTGGAGGAGGAGCAC
TACTTCAGTGACAGCTGGGAAATCTGAACAGACTCCGTCA
CTAGCTATGTTTCCATCCACCTCTTTTTAATGCACACTTA
AATTGGAATATTGCATAAAAAATGGGAACGCCTAGATGTT
TTGATGTGCATGAAAACTGATGCGCACAAGTGAAGCTGCT
GTCACACTAGACTTTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations