ZFIN ID: ZDB-TSCRIPT-110325-722
Transcript Name: ccnd1-004
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050351 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050351|OTTDARG00000016625|ZDB-GENE-980526-176 ccnd1|no_translation ccnd1-004 LG_ AL929586.19 Danio rerio protein_coding KNOWN, 673 bp
GAAATGTTAAAATCTTGAAATCCTAAGATTTCCATGCACT
TTTAGTATTAACGTGCACAAAGAGGCATGATTTATGGGAT
GTTTTGAGAATGAGAGGGCTGTGTAGGGGGTAGCTTGCTC
AGGACCTACAGCAAAGTTCTCTGCCTCCCCCGAAGGCTTT
GAGCCCCGCTGCAGAATGGCCTCAAATGTCACGGACTGTC
CCCTACCAACCCTGCTCTCATTATAGTTTAGTCATGCTAT
GCTTCATTATGAACCCAAGCAGTATTCCTCATAATGAGTT
TTATTCTGTTGGCTAGTTACTTTCTGAGAACGTCCTTAGG
TTTGACCAGAGTCCCCTTTTTATTTTCAGACGTCAACTTC
ATCGCAAGCCCTCCCTCCATGATTGCAGCAGGCAGTGTTG
CTGCAGCGGTACAAGGACTGTACCTGAAAAGCACCGACAG
TTGCCTCTCATCCCAGAACCTCACCAACTTCCTCTCGCAA
GTCATCAGAAGTGACCCTGACTGTCTGCGATCGTGTCAGG
AACAGATCGAGTCCCTGCTGGAATCGAGTCTCAGACAAGC
TCAGCAGCACATCTCCACAGAGACCAAAAGGGTCGAGGAG
GACGTGGACCTCTCTTGCACTCCCACAGACGTCAGAGACA
TTAACATTTGAAGGGATCGCTATTCATCTCGTG

ccnd1 TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript ccnd1-201 (1)    Ensembl 881
mRNA ccnd1-203 (1)    Ensembl 2742
ccnd1-204 (1)    Ensembl 840
ncRNA ccnd1-004 673
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ccnd1-004 Contained in:
[BAC] CH211-188I17 (1)

Genome Resources: Vega_Trans:OTTDART00000050351 (1),  Ensembl_Trans:ENSDART00000171395 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CT607208 (1) 878 bp
GenBank:CT734345 (1) 673 bp
CITATIONS (2)