Transcript

foxi1-201

ID
ZDB-TSCRIPT-110325-71
Name
foxi1-201
Previous Names
  • foxi1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000047696 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000047696|OTTDARG00000033842|ZDB-GENE-030505-1 foxi1|OTTDARP00000037457 foxi1-001 LG_ CU914622.9 Danio rerio protein_coding KNOWN, 1636 bp
ACATGAGTCCATTCACTGCATGCGCCCCGGACAGGTTAAA
TAACCCTCCCCTGAAGCGCACCCGGACACTCTCCTTGAGA
AACCCCTCAGAGACGAGCACACTCAGCAGGTCAGATCGGA
GAAACTCCATGTTTCTGGAGGGAGAGCGGATTATGAACGC
GTTTGGGCAGCAGCCGTCGAGCCAGCAGACCAGTCCCCTT
CAGCAGCAGGACATCCTGGACATGACCGTGTACTGCGACT
CCAACTTCAGCATGTACCAGCAGAACCTGCACCATCATCA
CCACCATCACCACCACCAGAGGCCGCCTGCGCATCCCTCC
AGCTACGGGCTCGGCGAGTACAGCTCGCCGAGCACCAACC
CTTACCTGTGGATGAACAGCCCGGGCATCACCTCCACCCC
GTACCTCTCAAGCCCAAACGGAGGCTCTTATATCCAGTCG
GGATTTGGATCCAACCAGCGGCAGTTTCTCCCTCCTCCTA
CCGGCTTTGGAAGCGCGGATTTGGGCTGGCTCTCCATATC
AAGTCAGCAAGAACTTTTCAAGATGGTCAGACCGCCGTAC
TCGTACTCGGCGCTGATTGCGATGGCTATCCAGAACGCGC
AGGATAAGAAACTGACGCTCAGTCAGATTTATCAGTACGT
GGCTGACAACTTTCCCTTTTACAAGAAAAGTAAAGCCGGC
TGGCAGAACTCTATAAGACACAACCTGTCATTAAACGACT
GCTTTAAGAAAGTTGCACGGGATGAGGATGATCCTGGGAA
AGGAAATTATTGGACTTTGGACCCAAACTGCGAGAAGATG
TTCGACAATGGCAACTTCAGAAGAAAGAGAAAAAGAAGAG
CCGACGGAAACGCGATGTCTGTGAAATCCGAGGACGCGCT
TAAATTGGCGGACACTTCCAGTCTGATGAGCGCGTCTCCG
CCGAGCCTCCAAAACTCCCCGACTTCCAGCGATCCCAAAT
CCTCTCCCTCTCCGTCCGCGGAGCACAGCCCGTGTTTTAG
CAACTTTATCGGTAACATGAACTCCATTATGTCTGGAAAC
GCGGTCCGAAGCAGAGACGGCAGCTCTGCACATTTGGGGG
ATTTTACGCAGCACGGCATGTCTGGACATGAAATCAGCCC
TCCCTCAGAACCAGGCCATCTCAACACCAACAGACTCAAC
TACTACTCAGCATCGCACAACAACAGTGGCTTGATCAACT
CGATCTCCAACCATTTCAGCGTCAACAATCTCATATACAA
CCGGGACGGATCAGAAGTTTAGAGAGTTCATCAAACCTCT
AATGTGTGCTCTGTGAGTACATGGACAAGCTGTAGATCAT
GTTTAAATGCAGTGTGTGTGTGGACTTTGGATGCATCAGG
CTTGGATGTGCATCTTTTACATTTATTCTGTGATAAATAT
ACAGTAGTCAACATTTGAAGCGGATCAAAAAGTTGTCTTT
AAACTATTATCCAACACCCATTCTTGTCATCTTAGGAATT
TTTTGTGATCCTCTTCAAATGTTTACTACTGTAAATACAT
CTAGGCCACTATAACAAGTGCCTTGTTGTTATTTTTTTTT
GTAGTACAAATGTAGATATATTTTATTTAAATGCGATGCT
TCTGATTTGTAAATAAAAACATGCGTATATCTGTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations