header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-71
Transcript Name: foxi1-201
Previous Name: foxi1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000047696 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000047696|OTTDARG00000033842|ZDB-GENE-030505-1 foxi1|OTTDARP00000037457 foxi1-001 LG_ CU914622.9 Danio rerio protein_coding KNOWN, 1636 bp
ACATGAGTCCATTCACTGCATGCGCCCCGGACAGGTTAAA
TAACCCTCCCCTGAAGCGCACCCGGACACTCTCCTTGAGA
AACCCCTCAGAGACGAGCACACTCAGCAGGTCAGATCGGA
GAAACTCCATGTTTCTGGAGGGAGAGCGGATTATGAACGC
GTTTGGGCAGCAGCCGTCGAGCCAGCAGACCAGTCCCCTT
CAGCAGCAGGACATCCTGGACATGACCGTGTACTGCGACT
CCAACTTCAGCATGTACCAGCAGAACCTGCACCATCATCA
CCACCATCACCACCACCAGAGGCCGCCTGCGCATCCCTCC
AGCTACGGGCTCGGCGAGTACAGCTCGCCGAGCACCAACC
CTTACCTGTGGATGAACAGCCCGGGCATCACCTCCACCCC
GTACCTCTCAAGCCCAAACGGAGGCTCTTATATCCAGTCG
GGATTTGGATCCAACCAGCGGCAGTTTCTCCCTCCTCCTA
CCGGCTTTGGAAGCGCGGATTTGGGCTGGCTCTCCATATC
AAGTCAGCAAGAACTTTTCAAGATGGTCAGACCGCCGTAC
TCGTACTCGGCGCTGATTGCGATGGCTATCCAGAACGCGC
AGGATAAGAAACTGACGCTCAGTCAGATTTATCAGTACGT
GGCTGACAACTTTCCCTTTTACAAGAAAAGTAAAGCCGGC
TGGCAGAACTCTATAAGACACAACCTGTCATTAAACGACT
GCTTTAAGAAAGTTGCACGGGATGAGGATGATCCTGGGAA
AGGAAATTATTGGACTTTGGACCCAAACTGCGAGAAGATG
TTCGACAATGGCAACTTCAGAAGAAAGAGAAAAAGAAGAG
CCGACGGAAACGCGATGTCTGTGAAATCCGAGGACGCGCT
TAAATTGGCGGACACTTCCAGTCTGATGAGCGCGTCTCCG
CCGAGCCTCCAAAACTCCCCGACTTCCAGCGATCCCAAAT
CCTCTCCCTCTCCGTCCGCGGAGCACAGCCCGTGTTTTAG
CAACTTTATCGGTAACATGAACTCCATTATGTCTGGAAAC
GCGGTCCGAAGCAGAGACGGCAGCTCTGCACATTTGGGGG
ATTTTACGCAGCACGGCATGTCTGGACATGAAATCAGCCC
TCCCTCAGAACCAGGCCATCTCAACACCAACAGACTCAAC
TACTACTCAGCATCGCACAACAACAGTGGCTTGATCAACT
CGATCTCCAACCATTTCAGCGTCAACAATCTCATATACAA
CCGGGACGGATCAGAAGTTTAGAGAGTTCATCAAACCTCT
AATGTGTGCTCTGTGAGTACATGGACAAGCTGTAGATCAT
GTTTAAATGCAGTGTGTGTGTGGACTTTGGATGCATCAGG
CTTGGATGTGCATCTTTTACATTTATTCTGTGATAAATAT
ACAGTAGTCAACATTTGAAGCGGATCAAAAAGTTGTCTTT
AAACTATTATCCAACACCCATTCTTGTCATCTTAGGAATT
TTTTGTGATCCTCTTCAAATGTTTACTACTGTAAATACAT
CTAGGCCACTATAACAAGTGCCTTGTTGTTATTTTTTTTT
GTAGTACAAATGTAGATATATTTTATTTAAATGCGATGCT
TCTGATTTGTAAATAAAAACATGCGTATATCTGTAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
foxi1-201 Contained in:
[BAC] CH73-329N5 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000047696 (1),  Ensembl_Trans:ENSDART00000159423 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC076476 (1) 1635 bp
GenBank:CF269286 (1) 1545 bp
GenBank:EH435668 (1) 948 bp
CITATIONS (2)