ZFIN ID: ZDB-TSCRIPT-110325-701
Transcript Name: aprt-201
Previous Name: aprt-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050253 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050253|OTTDARG00000035329|ZDB-GENE-040426-1492 aprt|OTTDARP00000039445 aprt-002 LG_ CR376726.14 Danio rerio protein_coding KNOWN, 473 bp
ATTCACAGTCCAAACATCCACAGCGTGCATCATGGCAGAT
AAGCTGGATTTAATCTCCAAGTGCATAAGAACTTTCCCTG
ATTTCCCTACGAAAGGCATTCCGTTCAAAGATATTTTCCC
AATCTTAAAGGACCCGAAGGCTGTTACTGCAGTGACAGAT
CTGTTTGAAGAGTACGTGAGAAACACTTACCCTCAGGTGG
ATCTCATAGTGGGACTTGATGCTCGAGGGTTTCTATTCGG
GCCACTTTTGGCTTTGAGATTAGGAATAGGATTCGCTCCG
ATCAGGAAAAAAGGAAAGCTCCCTGGTCCCACAATATCAG
TTGCCTATAGTCTTGAGCCGAGGCAGAGATGCAGGAAGAT
GCTGTATCTGCTGGACAGAAAGTGCTAATCATTGATGATT
TACTTGCTACAGGAGGCACTCTGTATGCAGCCATTGAGCT
GATCAAGCAGCAGAAGGCAGAGGTTTTAGGCTG

aprt TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA aprt-201 473
aprt-202 (1)    Ensembl 2741
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
aprt-201 Contained in:
[BAC] CH211-196P1 (1)

Genome Resources: Vega_Trans:OTTDART00000050253 (1),  Ensembl_Trans:ENSDART00000013796 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EB864039 (1) 473 nt
CITATIONS (2)