ZFIN ID: ZDB-TSCRIPT-110325-65
Transcript Name: mespab-201
Previous Names: mesp2-001, mespab-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000046876 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000046876|OTTDARG00000033344|ZDB-GENE-090817-2 mespab|OTTDARP00000036907 mesp2-001 LG_ CR854891.10 Danio rerio protein_coding KNOWN, 923 bp
AGCATTCACTCAAGCTCCAGAGAACCAGAAACATCTCCAA
GAACTCGACCATGGAGTTTAACCTTCCTCCTTACTTGCTC
CAAGCAGCCAAATGCAAACTCGAACCCATCTCGAGTGCTG
ATTGTGGTTACTTCAGCGCATGTGGGAGCCTTTCTCCAAG
CTCCTCCATCGATTCCGGATGCTTTTCTCCCCCTTGGGGA
GCTGGAAGACAACTGGAAGGTCCTGAAAATGCCAATGTTG
ACTGTTTGCAAGCTAAAAAGCTAAAGCTAGCTCTTCCCGT
TGATTCAAAGAGACGTTCCAGATCTAAAAACCCAGGAATG
AAGCGACAATCAGCAAGCGAACGAGAGAAACTCCGAATGA
GGGATTTGACCAAAGCTCTTCATCATCTCAGATCCTTCTT
ACCTCCATCTGTGGCTCCTGCTGGACAAACCTTGACTAAG
ATTGAGACCCTCCGTCTTGCCATTAGCTACATTTCACATC
TTTCTGACCAACTCAGACAGGCTGAGGTGCCAAATTATGA
GATGTGCTGCTCTGCTGAAGCTTCAGATAGGCTTCAGTCT
GGTCTGGTTTTTGAAAACGTGTGTATGGATGGACAACAGG
GACTCATGCAAGATAATGTTCAGTATTGTCCAACACTCAC
AAGCTTTGGAGATTCCAGAGAACAGATGGAGAACAGCTTT
CCTGCTACTTCACATTTCAGAGATGCACAGTCTTATATGT
TTCCCTGCACAACAATGGATGATGCTTCATATAGCCATCA
GTTTTACCAATGAAGGACGATGAGAGCTCAACTTGTTACA
GAATCCAATAGACTTTGACTTTGTTTGTGTATATTATTTG
TAATTATTTATCAGAAAACATATTTTTGTATTGGAGACAT
TTGTATATACTGCTTATTTATTGTCTTTTTTTAATTAAAC
CCC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mespab-201 Contained in:
[BAC] DKEY-52P2 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000046876 (1),  Ensembl_Trans:ENSDART00000099572 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC134250 (1) 964 nt
GenBank:CT734565 (1) 905 nt
GenBank:CT697562 (1) 836 nt
GenBank:CT688758 (1) 802 nt
CITATIONS (2)