ZFIN ID: ZDB-TSCRIPT-110325-649
Transcript Name: ddx4-205
Previous Names: ddx4-002, vasa-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050058 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050058|OTTDARG00000035216|ZDB-GENE-990415-272 ddx4|OTTDARP00000039292 vasa-002 LG_none BX571726.9,CU855689.3 Danio rerio protein_coding KNOWN, 2519 bp
CATAGCTGGCCATCTTTCTTTCTCTCGCGAGGCTCTTCAC
GCGTGTCCACCTGCTACCGGCTCTTCTGAAAAAAAGTCTC
ACCTAAAATTACCCAATATGGATGACTGGGAGGAAGATCA
GAGTCCCGTTGTGTCTTGCAGCTCAGGATTTGGAGGTGCT
GGAAATGACAAGTCAAACAGTGAAGGTACTGAAGGTAGCT
CATGGAAAATGACTGGTGATTCGTTCAGGGGGAGAGGAGG
CAGGGGAGGATCACGAGGAGGCAGAGGAGGCTTTAGCGGT
TTTAAATCAGAAATTGATGAGAATGGCAGCGATGGAGGTT
GGAACGGAGGTGAAAGTCGAGGAAAAGGACGTGGTGGTTT
CCGTGGTGGTTTTCGCAGTGGCTCCCGTGATGAAAATGAT
GAAAATGGAAATGATGATGGTTGGAAAGGAGGTGAAAGCC
GAGGTAGAGGTCGAGGTGGTTTCGGGGGTGGTTTTCGTGG
AGGTTTCCGTGATGGTGGTAATGAAGACACTGGGAGAAGA
GGCTTTGGAAGAGAAAATAATGAAAATGGAAACGATGAGG
GAGAAGGCAGAGGAAGAGGTCGTGGTGGTTTCCGGGGTGG
TTTTCGTGATGGTGGTGGTGATGAGAGTGGAAAAAGAGGC
TTCGGAAGAGGAGGTTTTAGAGGCCGGAATGAGGAAGTAT
TTTCCAAGGTCACAACTGCAGACAAGTTGGATCAAGAAGG
AAGTGAAAATGCAGGACCCAAGGTTGTTTATGTGCCGCCG
CCTCCTCCAGAGGAGGAGAGCTCGATATTCTCCCATTATG
CAACAGGCATTAATTTTGACAAATATGATGATATTCTTGT
GGACGTGAGTGGCAGCAATCCTCCAAAAGCAATTATGACT
TTTGAGGAAGCAGGACTTTGTGACTCACTGAGCAAAAATG
TATCAAAGTCTGGATATGTGAAGCCTACACCTGTTCAGAA
ACATGGCATTCCCATCATTTCAGCTGGACGGGATCTAATG
GCTTGTGCTCAGACTGGATCAGGAAAAACGGCGGCCTTCC
TGCTGCCTATCCTACAGCGCTTTATGACTGATGGTGTGGC
AGCCAGCAAGTTCAGTGAGATACAGGAGCCTGAGGCCATA
ATCGTGGCTCCCACCAGAGAACTTATCAATCAGATCTATC
TGGAGGCCAGGAAGTTTGCATACGGGACCTGTGTACGACC
TGTTGTGGTTTATGGAGGTATAAATACTGGATATACTATC
CGAGAGGTGTTAAAGGGCTGCAATGTTCTGTGTGCTACTC
CTGGAAGATTGCATGACCTCATTGGTCGTGGAAAGATTGG
CCTGAGTAAAGTGCGCTATCTAGTTCTGGATGAAGCAGAC
AGAATGCTGGACATGGGCTTTGAGCCAGAAATGCGCAAAC
TGGTGGCGTCTCCTGGTATGCCTTCAAAAGAGGAACGACA
AACCCTCATGTTCAGTGCCACCTACCCTGAAGATATTCAA
AGAATGGCTGCTGACTTTCTTAAAGTGGACTATATTTTCC
TTGCTGTTGGTGTGGTGGGTGGAGCATGCAGTGATGTGGA
GCAAACCATTGTTCAGGTGGACCAGTACTCAAAGAGGGAC
CAGCTGCTTGAATTGCTCAGAGCAACAGGTAATGAGCGCA
CAATGGTTTTTGTGGAAACCAAAAGAAGTGCTGATTTCAT
AGCAACATTTCTCTGTCAAGAGAAGATCTCAACCACAAGC
ATCCATGGTGATCGGGAACAGCGAGAGCGAGAGAAAGCTC
TCAGTGATTTTCGCCTTGGCCAGTGTCCAGTTCTGGTCGC
CACATCTGTAGCTGCTAGAGGCCTGGATATTGAGCAAGTC
CAGCATGTTGTGAATTTTGACATGCCCAGCAGCATCGATG
AGTATGTCCATCGCATAGGAAGAACTGGACGCTGTGGGAA
CACCGGTCGCGCCGTGTCCTTTTTTAACCCAGAGTCTGAC
ACTCCATTAGCTCGCTCCCTGGTCAAAGTCCTTTCAGGGG
CCCAACAAGTAGTTCCAAAATGGCTGGAGGAAGTTGCCTT
CAGTGCTCATGGGACAACAGGCTTCAACCCACGTGGGAAG
GTGTTTGCATCTACAGACTCGCGGAAGGGAGGATCCTTCA
AGAGCGATGAGCCGCCACCATCACAAACATCTGCCCCGAG
CGCAGCAGCTGCTGCAGACGATGAGGAATGGGAATAACTG
GCCTCACACCTGTTATATTTATTTTATTTTTATTTTATTT
GTGCGAGCTTCTTCAATACCATTTCAGGATATTTGTTAAT
GTTGAATGACTAAAGTAGCATTAGGATAAAGCTGTTGTAT
TTAGAGTCACATTGAATGCTGTAGGTTTGACCTCAAGGAC
GATAATCAAGACTAATACCTTTTGGCAGTTTAATTTGATC
ATCTTTTTGGTATCACTCGTTTTGACTGGAGCACATCTGA
AATAGTGGATTTGTTTTACTAGAGCACAAGTGCAGAAGTG
GGTGGGTTTGTTTAATCACATTTTAACACTTTGCTAGGA

ddx4 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA ddx4-204 (1)    Ensembl 2787
ddx4-205 2519
ddx4-206 (1)    Ensembl 2856
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ddx4-205 Contained in:

Genome Resources: Vega_Trans:OTTDART00000050058 (1),  Ensembl_Trans:ENSDART00000149095 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EB923583 (1) 287 nt
CITATIONS (2)