Transcript

gja8b-201

ID
ZDB-TSCRIPT-110325-639
Name
gja8b-201
Previous Names
  • cx44.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049965 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049965|OTTDARG00000035150|ZDB-GENE-010607-3 cx44.1|OTTDARP00000039211 cx44.1-001 LG_ CU896648.10 Danio rerio protein_coding KNOWN, 2459 bp
ATCAGACTGGATTCAGTCACTTCTGCTCATTCGGGCGACA
AGGATTGGAGGCCATAGGTGGGAACCAGAGAGCAAAAAGT
TCACTTCACACCACAGTGTGCCAAGAGAAGGGGGAACACA
AATACTCTGGAGCTCTTACTGTGTGCTGACAGTCAACCAT
GGGTGACTGGAGTTTCTTGGGCAACATCCTCGAGGAAGTA
AATGAGCATTCGACGGTAATCGGTAGGGTGTGGCTCACGG
TCCTCTTCATCTTCCGAATCCTCATCTTGGGCACAGCCGC
AGAGTTTGTGTGGGGCGACGAGCAATCGGATTATGTGTGC
AACACGCAGCAGCCGGGTTGCGAGAACGTTTGCTACGACG
AGGCCTTTCCCATCTCGCACATTCGCCTCTGGGTGCTCCA
GATCATCTTTGTTTCCACACCCTCATTAGTGTACGTGGGC
CACGCCGTGCACCATGTACACATGGAGGAGAAGCGTAAGG
AACGGGAGGAGGCTGAGCTCAACCGGCAGCAAGAGAACGA
GGAGAGGCTGCCGCTGGCGCCTGATCAGGGAAGCGTCCGT
ACGGCCAAGGAGACGAGCACAAAGGGCAGCAAGAAGTTTC
GTCTGGAGGGCACTCTCCTGAGGACCTATATCTGCCACAT
TATCTTCAAGACTCTCTTTGAGATCGGCTTTGTGGTGGGT
CAATACTACTTGTACGGCTTCCGAATCTTGCCACTCTACA
AGTGCAGCCGTTGGCCGTGCCCAAACACGGTTGACTGCTT
CGTCTCAAGACCAACCGAGAAAACCGTTTTCATCATCTTC
ATGTTAGCTGTGGCCTGCGTCTCACTGTTCCTCAATTTTG
TGGAAATCAGCCATTTAGGCTTAAAAAAGATCCACTTTGT
GTTTCGTAAGCCGGTGCGGCCGCAAGTCGAGGGACCAGGA
GCAGCCGAAAAGGCATTGCCTTCCATAGCTGCCTCATCGA
TCCAGAAAGCCAAAGGTTACAAGTTGTTGGAGGAGGACAA
ATCCACGTCGCACTTCTTTCCTCTGACTGAGGTTGGGGGG
ATGGAGGCTGGACGCCTGCCGGCTTCATATGAGCCATTTG
AGGAGAAATCTGACGAGGCCATGGCACCTAAGAAAGACAT
GTCTAAGATGTATGACGAAACGCTGCCCTCTTACGCCCAG
ACGACCGTGATTGGACCGAGTGCATCGTCAGGAATTCTGC
GCAGGGATGAAGATGAGGACGAGTTGGCTGTGGAGGCAGA
CATGGAGGCCAGCGAGACGATAGAAGATACACGACCGCTC
AGCAGCCTGAGCAAGGCCAGCAGTCGCGCAAGGTCAGATG
ACTTGACGGTATAAGTGATCCAGTGGAACTGGATTAGAAG
TGCAGCAGTGTAAGTTGTAGTTTTGGGGAAAGTGAGTAAA
CCTGAAAGAGATTTAGAAGAAAGGATGAGGTGCCTTTCGG
GCAACTGCGGCGTCACTTATAATACCAGCTTCTTTTTTTG
AAGGAAGGAAATGATTGAAAAAAATAATGCTGTGCAATTT
TCATGAGGAAACTTGAGAGCTTGATTCATTTTTTTTATAC
AGCAGTATTTTTCGTACTGTTTTTTATCAAACAGTTAACA
AACCAGAGCTAGGGATCTGCAGCAGCTAGATCTACACATA
GGGAGGAATCGGGAGAAGGTATTTAGCGAACAATATGTGG
TGTTTTTTTAATAATAACATTTTCTATCCAGAATTTTACC
GAGGCGAGATTCTGATGTTTACATTTTTGGATTAGCCATT
AGCTGAATGTTTGTTTGTGACATTTTTTGTTCTTATTCTG
ATAAGAAAACTGTCAGGGCATCATCCTTTTCACCTCAATC
ATTTCAACCATACATGATGATGATTACTCGATCAATCTTC
TTGATTTGTATGTGAATGGTACTGTAACGCATAGGTGTAT
GTGAGGTGACACAAATGCTGATGGTTTTGTTGCACAGTCG
TTCATCATGGCATAATAGTGACATAAAGACTATTTATTTA
AAAGAAATGACCACCACTGATATACGTCAAACATGATGAC
CTTGTTTCTGGTTTCACTCACTTACATTGAGAGTCATAAA
CTGAGTGTATCTAGCGATAACTGTAATAACTGCGTTAGCC
ATAGAAGAGATAGTAGGCCACATTCTTTCTAGTCTCTCTG
CGCAAGCAGCCATGATGATGATGATAAAGATCACGCCCAA
TCAGCACAAAGTATTGTTTAACAGGAGACAATAAAACAAC
ATTACATGACATGCCACCGCAGACAGTCTCACATCCTTGA
TGTTGTTGGAAACAACATTTGAGTGCTTTTTCCCTTCAGA
AAAGGACTGGAAATAATTCAGAATATTTCAAAAGGCCAGA
ACAGAAGTGTTTTGCCCCTTGATTAAGTTAATATTTTTAG
CAGAGACACCTTGTTTTTGGTTTTAAATATGCCTAGGAGT
TTAGAGTGATGTATAGAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations