Transcript

gja8b-202

ID
ZDB-TSCRIPT-110325-2454
Name
gja8b-202
Previous Names
  • cx44.1-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049964 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049964|OTTDARG00000035150|ZDB-GENE-010607-3 cx44.1|OTTDARP00000039210 cx44.1-002 LG_ CU896648.10 Danio rerio protein_coding KNOWN, 1248 bp
ATCAGACTGGATTCAGTCACTTCTGCTCATTCGGGCGACA
AGGATTGGAGGCCATAGTGCTGACAGTCAACCATGGGTGA
CTGGAGTTTCTTGGGCAACATCCTCGAGGAAGTAAATGAG
CATTCGACGGTAATCGGTAGGGTGTGGCTCACGGTCCTCT
TCATCTTCCGAATCCTCATCTTGGGCACAGCCGCAGAGTT
TGTGTGGGGCGACGAGCAATCGGATTATGTGTGCAACACG
CAGCAGCCGGGTTGCGAGAACGTTTGCTACGACGAGGCCT
TTCCCATCTCGCACATTCGCCTCTGGGTGCTCCAGATCAT
CTTTGTTTCCACACCCTCATTAGTGTACGTGGGCCACGCC
GTGCACCATGTACACATGGAGGAGAAGCGTAAGGAACGGG
AGGAGGCTGAGCTCAACCGGCAGCAAGAGAACGAGGAGAG
GCTGCCGCTGGCGCCTGATCAGGGAAGCGTCCGTACGGCC
AAGGAGACGAGCACAAAGGGCAGCAAGAAGTTTCGTCTGG
AGGGCACTCTCCTGAGGACCTATATCTGCCACATTATCTT
CAAGACTCTCTTTGAGATCGGCTTTGTGGTGGGTCAATAC
TACTTGTACGGCTTCCGAATCTTGCCACTCTACAAGTGCA
GCCGTTGGCCGTGCCCAAACACGGTTGACTGCTTCGTCTC
AAGACCAACCGAGAAAACCGTTTTCATCATCTTCATGTTA
GCTGTGGCCTGCGTCTCACTGTTCCTCAATTTTGTGGAAA
TCAGCCATTTAGGCTTAAAAAAGATCCACTTTGTGTTTCG
TAAGCCGGTGCGGCCGCAAGTCGAGGGACCAGGAGCAGCC
GAAAAGGCATTGCCTTCCATAGCTGCCTCATCGATCCAGA
AAGCCAAAGGTTACAAGTTGTTGGAGGAGGACAAATCCAC
GTCGCACTTCTTTCCTCTGACTGAGGTTGGGGGGATGGAG
GCTGGACGCCTGCCGGCTTCATATGAGCCATTTGAGGAGA
AATCTGACGAGGCCATGGCACCTAAGAAAGACATGTCTAA
GATGTATGACGAAACGCTGCCCTCTTACGCCCAGACGACC
GTGATTGGACCGAGTGCATCGTCAGGAATTCTGCGCAGGG
ATGAAGATGAGGACGAGTTGGCTGTGGAGGCAGACATGGA
GGCCAGCGAGACGATAGAAGATACACGACCGCTCAGCAGC
CTGAGCAAGGCCAGCAGTCGCGCAAGGTCAGATGACTTGA
CGGTATAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations