header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-630
Transcript Name: syne1b-202
Previous Name: syne1b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049930 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049930|OTTDARG00000035128|ZDB-GENE-071218-4 syne1b|OTTDARP00000039182 syne1b-001 LG_none BX936315.11,BX511113.8,BX927406.24,CR407704.10 Danio rerio protein_coding KNOWN, 27036 bp
AAGCGTCATCTGCTCACGATAGAAGAGGACTTCTGGTTGG
TCGAACTCCTAAATGAAACCTGCTTTTCTATTGGATAGCA
TCAAGTTATTGGAGTTCCTGCATCAGAGAGAGAGGAAGAG
AGAGAGAGTGTGTTGTAGGAGGGGCAGATGGGGATGCCCC
CTTAAGAAAGTAGTGCAGTATCTGCTGTCTACAGTACCGA
CTGCATGACTGATTCGCTTTCAGAGGAGCACAGGACTGTA
GAGAGGAGCCATGGCTTCCCTCAGCCCTTTCGGACGGTCC
AGCAAGGACATTATGAATTTGATGCAAAAGCTGCAAGATG
AACAGGAGTCGGTGCAGAAAAGAACTTTCACAAAGTGGAT
TAATTCACACTTGGCCAAGCACAAACCTCCTTTTGAAGTC
AACGATCTCTTCGAGGACATCAAGGATGGGGTGAAACTGC
TGGCTCTGCTCGAGGTGCTGTCTGGCCAGAGATTACCATG
CGAACAGGGCCGCCAACTCAAAAGGATCCACTGGGTGTCT
AACATTGGCACAGCTCTAAAGTTCCTGGAGGGAAGGAAGA
TCAAACTAGTCAATATCAATGCTACTGATATTGCTGATGG
ACGCCCGTCAATTGTCTTGGGGCTGATGTGGACCATTATC
CTCTATTTCCAGATTGAGGAGCTGACCAGTAACCTCCCAG
CCCTTCAGGCTTTATCCAGCAGTGCGTCTTCAGTGGACAG
CATGGCCAGCTCTGAGACCGGAAGCCCACCAATGAAACGC
AAGGTGGTCACCAAGTTTCAGGGCAATGCCAAAAGAGCTC
TGCTCAGATGGGTCCAAAACACAGCAACCAAGCGTCTTGG
GATTGAAGTTAAAGACTTTGGTGCTAGTTGGCGTAGCGGC
GTAGCCTTCCATTCTGTTATTCATGCCATTCGGCCAGAAC
TCGTGGACATGGACGTCGTGAGGAAAAGAAGCAATCGAGA
AAACCTGGAAGAGGCGTTCAGTGTAGCAGAGAATGAGCTG
GGAATACCACGCTTACTAGATCCTGAAGATGTGGATGTGG
ACAAGCCTGATGAGAAATCCATAATGACCTATGTAGCTCA
GTTCCTGAAGCACTACCCAGATCCCCACCAGTCTGAGACA
GATGGACAGCAAGAGGAGCGAGAGGAACGCAAGGTGCTGA
GAGAGGTGAAGATCTGGCTGGATCAGCTGGAGAGAGATGT
ACTGCGGGCACAGGGATCTGAAGAGAGTCTCACTGACAAA
TATCAGGCCTTTAAGAGCTTTCGTGTGCAGTATGAGATGC
GAAAGAAGCAGATCGAGTCTCTCCTGCAACCGGTGCACAG
GGACGGAAAACTCTCAGTGGACCAGGCCGTGGTCAAGCAG
TCCTGGGATCATGTGTCCGTCAGGCTCTTAGACTGGCACA
TCCATCTGGACAAATCTTTGCCTGGTCCTCTGGGAGTGAT
CGGGGCCTGGCTGCATCGGGCAGAACTTTCCCTGAGAGAG
GACGTCCCGATTCAACAGGCCCACGAAGAGACGGCCAACA
TCATCCACAGAAAACTGGAGCAGCACAAGGAGGTGTTAAA
GAACTTGGAGGGACACAGACAGACATTTCAGCAGATTCAC
AGAGACCGATCGGTAAACGGTGTACCGGTACCACCAGAGC
AGCTTCAGGACATGGCAGAAAGGTTTAATTTCGTGACCAC
GTCATCTCACGTCCATCTAATTAAATTCGAGTTCTGGGAG
ATGAAGTATCGCCTCATGGCATTTCTAATGCTGGCGGAGT
CAAAGCTCAAATCATGGATCATTAAATACGGCCGGCGGGA
TTCAGTGGAGCTCCTCCTGCAAAATTACATTGTGTTCATT
GAAGGTCACAAGTTCTTTGAGCAATATGAAACCACTTTCC
GCACCCTGAAACAGGCTGCAGACACCTACTTGAAATCTGG
GACTTCAGCTGAAGAGGTTGAGGGAGTGAATAAGTTTCTG
AGCGATGCAACAGCACAGTGGAAAAACCTCTCCGTGGAGG
TGCGCAGCGTCCGCAGCATGTTGGAGGAAGTGATCTGCAA
CTGGGAGAAATACAGCAGCACAGTGGCCAGCCTGCAAGCC
TGGCTGGAGGATGCAGAAAAGATGCTCAACCAATCAGAGA
GCGACAAACGGGAGTTTTTCCGGAATCTTCCTCACTGGAT
TCAGCAGCACATGGACATGAACGATGCTGGGAACTTCCTG
ATCGAGACGTGTGATGAGACCGTGTCCAGAGAACTGAAAC
AGCAGTTGCTGCTTCTCAACGGCAGATGGAGAGAGCTGTT
TGTCAAAGTCAAACATTATGCAAGAGCAGACGAAGTGGAC
AAATTGAGGAAGGATTATGATGACGGGATTGAAGCTTTAA
AGGCGTTTATTGACACGGCCAATGAAAGGATGAACACTCC
CGTTCAAGTGTCTTTTCTCAACATACGGACATATCTACAA
GACGTTGAGGACATCAAGCACAAAGTGCCCTCCATGGAGG
CGGCCTATAAGACGGCCACACGCAACGCACAGCAGCTGAC
CAAAGACCTTTCAGAGGACGAGATTGCACACATGCTGAAT
AACATGACAAACATCAAGGATGAGCTCAGCAAGATAAGAG
AGAGAGCTCTGCCCCTGCTGAGGGACTCGCAGGCCATGCT
GCCTCCACTGGAGGAGATGGAGAAAAATATCACTGGGTTC
TACCAGTCGCTGGAGAAGGCCAGCCGCATCACTTCCTCTC
GGGACTCAGAAGCTCCAGGAGACTTCACGCAGAAGTGTCA
GGAGCTGGTGACCTATCAGCAGAGCTGTAAAAAGTGTCTG
TCAGTGATTGATAAAAACCATCAGGTTATTCTGAAGTCAC
TGGACACCAGTAAGAACCTCAAGCACCTGGACACATCACT
GCTGGAGAGGAGAATCACTGAGCTTCAGGCTTCTTCACAG
GGCATGGTGAAAGAAACCACAGAATGGAAGCAGCATGTGG
AGGCGAACAGCAGCCTTATGAAGAGATTCGAGGAGTCTCG
TGTGGAGCTGGAGAAAGTTCTCAAAATAGCTCGCAGCTCG
ATGACTGAGAGAGGAAACCCAGAGGACCTTCTGAAAAAGC
ACACTGAGTTCTTCGGTCAGCTGGATCAGAGAGTTCTCAA
TGCGTTTCTGAAAGCCTGTGATGAGCTGACAGATATTCTG
CCAGAGCAAGAACAGCAGAATCTACAGGAAACAGTCAGGA
AGCTGCACAAACAGTGGAAGGACGTCCAGACAGAATTTCC
CTATCACCTGCTGCATCTGAAGGTGGATCTGGAGAAGAGT
CGCCTGATGACATCACTGCAGGAGTGTCAGGCCGAACTGG
CCCGCGAAAACCGCAGTTTGCCCAGTGTCGGCAGCGAGAG
GTTAATTAAAGAGCACCGAATGTTTTTTAAGGAAAAGGGT
CCACAGGCTCTTTGTGAGAAGCGGTTACAGCATATGGATG
AACTGTGCTTGAAGCTCCCGGAAAGCCAACAGGCTCAACA
AACCCTGGTGATCGCCAGAACAGCATTTGCAGAGGTCAAA
GAGGAGATTGACAGCACACACCAGAGACTAATGCAGCACC
CGGACAAGTGGAAGGAGTTTAACACCAGGTTTTCTGAACT
CTCTGCTTGGGTTACATCAAAAGAAAGTCAGCTCAGACTT
TTGCGAAACAGAGCTGGAGATCCCAGCAAGTTTGGACAAG
TCAAGTCCACCATTGAGAGTCTGAGGAACGATGCTGAACT
GCAGGAGGGGAATGTGAGCTGGTTGAAGAACCGTTTGGCT
GCTCTGATCGAGATCTGCACAGAAAGTGATGCTCAGAGGC
AGGGAGCCGCTCTCAGCAAACTCTCCAATGACTTCAAGGG
TCTCCTCATCTCCCTTTCTGAGTCCGAGAAGGTGGTGCTG
GCGGTCAGCGACTGTGTGCAGTTCAGAGAAGAGGTGAAAA
CCACACTGGAGGAACTGACTCAGGGTCAGAAGGAGCTTCA
GTCTGACAACAGCAAGATTCTGGACTCAGAGTCAGTCAGA
GAAGCTCAACAACTCTTGCTGCTTCATCAGCAACAGCTGA
AGCGCCTCCGGTTGAAGAGGAAAGACATGCAGGAGCAGAT
AAACCGCGGAAAGCAGCTGCAGATCGAGGAGGGTTTGGAA
GAGAGTTTACAGGATGACCTGCAGAAGCTAGAGTCCACTC
TGAAGAAAATGGATGAAAACACTGAGTCACAGGAAAAGAA
TCTGGAGGTGACTTTATCAGCCTGGCAGGAGTTTGATGCT
CAGCAGGCGTCAGTGAGGGAGTTTGTGGGTAAAGTGCGAT
CCGTCACAGAGAGAGAGATGAACTTCAGCAGTCCAGAGAG
CCTGAGCTCAGAGCTGGAGCAAACCAAGGATCTCCTGAAA
CAGTGTGAAACGGAGGTCAGACAGGTGAACACACTTCTGA
AAAGGGCCACAGAAATCCAACTGGGCCCCAAAAACCAGTC
TCTTCTTCAGGATCAAGCACGAGCTTTGAGCGAACAAGTG
GACAAAGTAGAGAAAGGACTCAAGCGAGATGTGAAGACTT
TGGAGGGAATGAAAAGTCAGTGGGATTTGTTCGGGAGTGA
GTTTGAAGCGTTTTCCTCATGGATAATGGAGAGAGAAAGA
GAAATGGATGCCTTAAAAAGCTCCAGCATACCTTTGGACC
AGCAGATCTGTACTGTACAGACCATCAGAGACGGTCTGCA
GGAGAGATCAGAGGTCCTGTCTAATCTGGAGGAAAAGTCT
CAATCGCTCGTCCAGTTTGTGTCATCTGGCGAATCTGCAC
GAATCAAAGCCCGGCTGACACAGATCGGCAGATACTGGGA
GGAGCTTAAGGAGAGTGTGGACCACCTGAGTGGACAGCTG
GAGGAAAGCTCCTCCCACCAGACTAAGTTTAACTCCAATC
TACAACAGGTACAATCAGAAGTTGAAGAGATCCAGAAGAA
ACTTGACAACCCCGTCACCTCCTGCATATCTTCATCCGAG
ACCTACAAAACTCTACAGAGTCACATGGATGTGTTTCAGA
GTCTGGAGAAGCTGAAGGCCACGCTGCTGTCTCTGTCTGC
TGGCGCCCGCAGGCTCAGCGAGAGGGAGAAGGCAGAGAGA
GCCGTGGCGGCCCTACAGCAAAACTATGAGCAGTGTTTAA
AACAGGCCAAGGAGAAACAGAACCAAACCGAGAGCCTTCT
GTCACACTGGCAAAAGTATGAAAAGGATTGGTCTGCACTG
AAGTCATGTCTGGAGAGATGTGAAGCTGCGTGTGGCCCTG
ACAGTCAGTCTCTGCCAGTCGACAAACTAAAGCTGGATGG
AGAATTGCTGGAACTAAAACACCTGCAAACTGAGCTTGAG
TCCCTGGAGGTAGTTTATAACAGACTCGGGGCCCAAACAC
CGTCCCTTTACACCACTGCATCAGATGAACGCGTGAAAAC
ACTCAAAGAAGACCATCAACAGCTGGAGAAAAGATGGATG
TGTCAGACAACAGCTATACCTCACAGAATCCAGGTCCTTC
AGCAGCATCTGTCCCAGGTTGATCAGTTTGATCAGGCTCT
TCAGAAGTTTTTCAAATGGGGAGAGTCTTTTCTGTCTTCT
CTACACTCCTCCTCTCACACTGATATCACTGATCTTCAGC
CTTCCACCAATGATATCAAGGAAAAAAGAGAAGCTCTCCT
AAAGCAAAGCATCGTCCGGCAGAATCTTCAGCAGCAAACT
AAAACCCTGTGTGACGTTTGTGAGCCAGCTGAAGTCCAGC
ATCTTCAGGGAAGGTGGGAGAGCTCCTTACAGCCGTACCT
GGAGGCCCATCAGCTGGTTGAACTTCGAGGAGAGAGTTTG
GAGAAACTGGAGGCCTTTCTACACACCCACAGTGTGGCAG
CGGGCGTTCTCCAGGGCCTCAGACAGACCGTGGAGAGCGC
TGGGAGTTGGGATAAAAGCCGGGTGGAAGAGCTGCAGAGA
GAGCTGGAAGCCATCGTTCCGGATATCAGCCGCCTTGAAA
CGCTCGCCGTGAATTTGGACGGCAACCTGTGTAAATCTCA
CCTGCACTTAATGAGCGGGAAAGAGACACGGTCCTCGTGT
CGTTCACTGGCTGACTCCTTGAGCGCTGAATTGGACGCCG
TGAGAAACCTACTGGGCTCCAAACAAAGCGAAGCTGAGGC
TCTCGGTGCTCTTTGGAGCTCCTTCAGACAGCGTAAAGAA
CAGCTGCTGAAAACTGTGGAGGATATTGAGGAGAAGGCGG
ATCAACAGGGCCTGAAGGAGCCCAATGTGCTTACTCTACA
GCAGAGGCTTCGGTTTTTCAATCAGCTGGAAGATGAGCTC
CAGTCTCACCAGCATGAGGAGCAGTGGCTCAGGGATAAAG
GTCAACAGCTCGCTCACAGAGATGCTGAGCTGGGCAGTGA
AGTGCTAAGAGAGATTAACCTGCTTCAGACTACCTGGGAG
GACACTAAGAAACTCATTACTGAGAGACAAGAGCAAAGCA
GTGCTTTAGTAGACCTCATGAAAGACTACCAGACTCTGAA
GTCTTCAATAAACTCCATTTTGGAAAGCGCTGATGCAATA
GCCGATATTAAATCTGTCCTGAAAGATCAAGAGGACACGC
GGAGATCCTTGTTGAAGCATGAAGCTGTAAAAGCAGACAT
GGCCAGTCACCAGGATGTACTAGACCGATTCTCCAGTAAA
GGGAAGAAGCTTTTAAGTGAATTAAACAAGATCCCTGATT
GTGACACACAGATTGTGAAGACAGAAATAGATGCTACAGT
GGACCAGTGGCTTGATGTGTCCGAAAAAATCGAGGACAAT
CTGGAAAGTCTCAAGAGGAGTTCTGCTCTGTGGGTGGAAA
TCTACGATATCAATGGAGAAATCGAAAGCTGGTCCAACAG
CTCGGTTATGGATCTTACAGATGGACTCAATAACTTCAAC
GATAGCCAGAAAACCGCACACAAACTCTCTGAAGTCAAGG
TGGATGTTGGCCTGAAAGAAAAGAAGATTGATGCTTTACA
AGAGAAAGTTTCCGAGATGAAGCAACTCTGTGGTGGACAA
GATGTCCCCGCTAAACTACAGGTCATGGAGACGGACCTCA
GAAGGAAACTTAATAGCATTGAAGAGTTATGTGATCAAGC
CAAGAACAACCTCCAAGATTTCTGCTGTCAGAAGAAGCAG
CTGGAGGATTTCCTCAGCCAGATGTCTGAGTGGCTGATGA
GCGTTGAGAGATCTTTGGTGGATTCACCGTGTGGAACGGC
TCCTGAAGAGATCTGCAGAGTCAAGGAGATCCAAAAGGAG
CTTCAGAACCAGCAGGCGAGCATTGATTCAGCCCGGGAAA
GCTTGAACACGCTTTGCAGGAAATACCCATCTGAGGAACT
AGCTGGTCTAGGATCTTCCCTAACCGACCTCATCAAGAAA
TATGAAACAGTCAATCAGATCTGTGTAAAAAGGCTCGGGT
CCATGCAGCATGGCCTCCAGCAGCACTTTAATGATCTTGT
GAAGGAGTTTCATACGTGGCTCTCAGGACAGAAAGACATT
GTGAGAGAATGTGCAGACCATTCGGGTGATATGAGCGTGG
TGGAACGCAAACTGCAGAAACTGAAGGGAGCTCTGGAGCG
GGTGGAGGATGGAGACGACCGTCTAACACTGGTCTGTACA
GAGGGAGAGAAGCTTCTTCTGCATCTCCCCAAAGCCAGCG
CCGGTCAGGTTCAACAGAGCCTCTCCTCCATCCAGCAGGA
CTGGGACAGTTATGTGGAGCAGTGCAGACAGAACCAGCAG
AACCTGGAGGACAGCGCCAGTCTGCTCAGCGGGTTTGACG
GCCGTCTGCAGAGACTGAGCCGCTGGCTGGAACGCATGGA
TGTGAAGATGAGCACAGAGCTGCCAGAAGGAAGACATGGC
GATCAGGAGAGAGTCACGCTGGAGCGGGTGGAAGAATTCC
AGCATGAAGTGCTCAAAGAGAGGGACTCGTTTGAGGGTCT
GTGTCAGGAGGCTCAGGCTCTCAGTGAAGGAGGTCACGGC
AGCGGGTCAGAGGTCAGAGCGTCTGCGCAGCTGCAGCACC
AACATCAGTCTCTGCTAAAGGCTGCACGGGAACGGCTGCG
CGTCTGTCAGCTCAGCATGCAGGAGCAGCAGAACTTCCAG
GAGACACTGCAGAGCACATGGCTGTGGCTGAGCAGCGCAC
AGGAGCGGCTCACTGCTCTCAACAGCACCGGCGGGAATAA
AGAGACACTGGAGAAGAGACTGGCGCTCGTTCAGGACATC
TTGCTGATGAAGGGTGAAGGGGAGGTGAAGCTAAACATGA
CGGTTGGGAAGGGCGAGCAGGTGCTGAAGAACTGCAGTCG
AGACAAACAGGAAGTGATTCGCTCTCAGCTCAAGAGTCTG
AAAGATTCCTGGGCCAATATTCTCATGACCGCCATGAGCT
GCCACAGTCGTCTGGAGTGGACCGTAGCTCAATGGAGCAG
TTTTCAGGAGAGTAAAGCACAGCTCCAGCAGTGGCTGGAG
ATGGTGGAGCAGGAGGCAGGAGTGGCTCTACCTCAGCAGC
CCGGGCTGAAAGAGAAAGCCGCTCTGCTGGAGAGACTACG
GGTCATTCAGGCAGATGTGGAGGTCCATTCGACAGCACTG
AGTCGCCTCAATGAGAAAGCCACAGAGCTGTATGAGAAGA
CAGGAGACCAGGCGTTTGCCGAGAGACCAAAATCTGACTT
TAACACACAGTTTACCAACATCACTGCGGTCATTAAAAGT
AAAGTCCAGCAGATGGAGGAGATTGTCAAAGAGCATGAGC
AGTACATGGAGTCAGTGCGGGACCTGAATGACTGGCTCAC
CTCGGCTAAAGAGGAGCTTCAGCGCTGGTCAGACATGTCT
GGAGATGCAGCTTCTGTTCAGAGGAAACTCTCTAAAGTCA
GAGGTCTATTAGACTCGAGGAAGCAGGGACGTGAGCGTCT
GACCCGAGTGCAGAGCTGCGGTGCCGCCACACGTGACCAC
ACATCTACAGTGGGCTGTGAGGTCCTGGAGCGGGAGGAGG
CCGGGCTGCTCTCCGCCTGGGAGCAGTGGGAGCGCGGAGC
CAAACACGTGTGCTCGGGTCTGGAGGGTGTTCTGGCTCAG
ATGGCAAACTCCGAGCAGGAGTTCAACAGTTTGGCTGCGC
AGCTGGAGCAGGACCTGCAGGAGTTCAGCAGCAAACTGCA
AGAGTGGCGCATCAAGCTGCAGCAGGTGGAGGAGATGAGT
GCAGGAGAAGAGGCTGTGCAGGGCTGGCAGATAGCCAAGG
ACACCCTGGAAGCTCTGCAGAATGTGGAGCCCATGTCTGA
CAATCTAAAGTGTCAGCTGAATGACTTGTGCCGGTTCTCC
AGAGATCTGGGCGCTCAATCTGAAAGAGTGTCTGCACTCA
TTAAAGAATACAACAGTCTCAGTCTCCAGGCGTCTCGAGA
GTGTCAGGGAAAGGAAAAGCTGCTGGAGCAGAGGTTTCGT
GCTGCTTTTCGAGACTTCCAGCAGTGGCTGGTCAATGCCA
AAATCAATACAGCCAAGTGTTTTGACGTGCCTCAGAATCT
GGCTGAGGCATCGTCCAGCCTGCAGAAGATCCAGGAGTTT
CTGAGTGACCGAGAGCAAGGCCAGGGTAAACTGAACACAG
TGGCGGCAAGTGGAGAGCTGCTGATGAGCATCGCTGCTAA
AGACAGAGTGGAGTCAGTCAGAGCTAAAATCAACTCAGCC
AGAGAAGACTGGAAAACACTCATGACCAACCTGCACCAGA
GAGAGAACGCCTTACAGAATCTCCAGGCTCAGATGCGGGA
CTTTGAGACAAGCGTGGAGCCCCTTCAGGACTGGCTGAAT
GACACTGAAGAAGCCGTTCAGGAGAGCAGCAGTCGACTGC
AGGACCTCACAGCTAAGAAACAGGAGCTGCACAGGTTACA
GTCTCTGCTAGAGGAATTAGCCTCTAAGGAGCCTCAGCTG
CTCAGGTTGCGGGAGAAGGCCCAGCAGCTGTGGGACGGAC
ACACGGCCGGAAAGGGCTTTGTGCACCGTGTCTCGCAGCT
CTCTGCTCAGTACCTAGCTTTAAGCAACCTGACCAAGGAG
AAAGCCTCCAGAATTGAGCGTGTGGTGTCTGAGCACCAGC
TGTTCTCTCAGGGCCTGAAGGAGCTGCAGAACTGGGTGTC
CGACACCAGTCACATGCTGCAAACCTACTGCACTCCCACC
GCAGACAAAAACGTGCTGGATAGCAGGATGATCAAACTAG
AGGCTTTACTTACAGCCCGTCAAGAGAAGGAAATCCAACT
GAAGATGCTGCTGACCAGAGGAGAGTCTGTCCAAAGGAAC
ACCTCCGCTGATGGGGTCCCGCTCGTCCGCCAGCAAATCG
AGGACCTCAAGGACTCCTGGGATGGACTGCTGTCAGCATC
TATACAATGCAAAAGTCAACTGGAAGGCGCTCTATCCCAA
TGGACCAGTTACCAGGAGGACGTGCGCCAGTTTGTAAGCT
GGATGGAAACTGTGGAGGAGACTTTAAGCTCAGCGGATAA
ACAGTGTTCGGAGATGAGAGACAAAACCACCAATCTGGGC
AAAGCCAAACTGCTCTTAGAAGACGTTTTGAGTCACAACA
GCGTCTTGGACGTCATATCCATGAAGGGATCCAACATGGC
TGAACACTATGTCACCCAGCTGGAGATTCAGGACTTGCAG
GAGCGCTACAATATTGTCAAAGATAAAGCTCAGTGTGCGG
TTGCTAAAGCGGAGGAGCTGGTTTCGGCTCATCAGGAGTA
CCAGCACAGCCTGCATGAGTTTAAAGACTGGCTAGATCAG
CAGCAGGAGAGACTGAGCTGCTACACACAGCTGGAGGGAG
ACACCGAGACGCTGGAGGACACACTGCGCAAACTACAGGA
GCTGCAGGTTCACTGTACAGAAGGTCAGGCTCTCCTCAAC
ACTCTGCTGGTGAGCAGAGAGCAGGTGATTCCCTGGGGCG
TCCCTCAGCTGGAAGACCGCTGTCTGGAAGGCGTCCAGCA
GGAGTGGAGCTCGTATCAGAGCCGGCTCACTGACACCAGA
TCTCAGCTAAACAGCGCTCTGGCTAAACTCCGGCAGATCG
AGCAGAAGTTCCAGCGGCTGGACAACTGGCTGAAGGGGAT
GGAGAGTAAAGGCCAGTTACGTACCGGACGCCGCTCCGAC
AGAGCAACCAAAGAGGCCCAGCTGCAGCTCCTGAAGGGCT
GGCATGAGGAGGTGTTGGTCTACCAGGAGGAGATCGAGGG
TCTTAGTGTTTTGGCCCAGCAGGTTTTAGAGGAGACGCCC
ATCAGCAGCAGAGTCAGCACTCGAGCCACACAGCTGACCT
CACGCTATCATGCACTGCTGCTGCATCTGCTGGACACTAT
TAAGCAGCTAAAGGAGGAAGTGTCCTGCATTGAGGAATCT
CAGAGTGTGTTCTGCACCTTCTCTGATTGGTTGAGCACAG
CACAGAAGAATTTCAGTAGCGTGACCACCACCAACATTGA
TGTGGTCGATCGGGCTGCCATGGAGAAGAAGATGAAAAAG
CTAGAAGCTCTGCAGGGCGACATGGAGCTCGGTCACACTT
TCCTTAAGACCATGCGTGAAAAGACGGACCGTGCCATGAT
GTTCCTGGAGGAGCCCGAGGCAGAGCAGCTGAAGGAGGAG
GTGGACAGCAGACTCTCTCAGCTGGAGACACTGATCAGAG
CTCTGCGATCCGAGATCAGCGCCACCGAGAAATCCATACA
GCTCTCTAAAGACTTCCTGGACAAGTATAAGACTCAAACA
CAGTGGCTTTCAGAGACAAAATCACTGCTGGCGTCCCCTG
TGGAGCCAAAGGCCGAACTCTACCAAAAGAAGGCTCAGTT
GGCCAAATATAAGACAATCCAGCAAACCATCCAGTCCCAC
GAGTCAGCCGTCAAATCAGTAATCGAGAAAGGAGATGCTC
TTCTTGAAACCATCCGGGACCCGTCCATCAGCGAGAACAT
CGGCAAGCTGAAAACTGACTATCAAGACTTATGTGCTGAT
GCCAAGGTTCATGTTCAGAGTTTGACAGAGAGCGTGAGGG
AGCATGAGGACTATAACAGTGAACTGCAGGAAGTAGAGAA
ATGGCTGTTACAGATGTCAGGCAGACTCGTCACCTCTGAT
TCAATGCAAAGTGGCAACCTGGAGATGGCCACACAACAGC
TAGCCAGACACAAGGCAATAATGGAGGAGATTGCTGGATT
TGAGGAACGGTTGAGCAGTCTGAAGGACAAAGGTGACCAT
CTTGTCAGTAGCTGCACAGAGCAAGTCCAGGCCAAGATCA
GTCAGCAGATCCAGGCCCACCAGCAGGGAACCAGAGACAG
TTATTCAGCTATCTGCAGCACAGCACAGCGTGTGTATCAG
AGTCTGGACCGTGAGCTCCAGAAGCACGTCAGCCATCAGG
ACACCCTCCAGCAGTGTCAGACATGGCTCTCCTCTGTTAA
AGAGGAGATTCAGATGCAGCCGCAAACTCCCTATGGTCTG
CAGGAGGCTCTGAAACAGGTGAAACACTTCAGGGCCCTAC
AGGAGCAGGCCAGCACGTACCTAGATCTGGTTTGTTCAGT
GTGTGATTTATCTGATGAGTCTGTGAGAGCCACAGCTGCC
AAAATACAGCAGACCAAAACAATGATTGAGGAGAGGATGA
GCACTTCTCAAGAGCTGTCAGATAGCTGGAGGGAGATCAA
AGAGCAAAAGCAGGAACTCTCGACACTCTTTCAGGACATG
GAGCAGCAGCTGCAAAGTCTCTCCAGAAGACCCGCTGAGC
TGGAGACCAAGATTGCTCAAAACATGCTTGATCAAGCCAG
GGAGTTTGGCCAACAGCTTCAAAACAGACAAAGCACTCTG
ACCAAGATGACAGAGCTTGTAAGTAAGCTGACAGAGGGCA
AGGAGTCTCCTGAGCATACAGAGATCGGCCGACTGAGTCA
CGCGTGGCTGGAACTGTGTCATCAGGCCAACAAACTCCAA
ACACAAAGAGAAGAAGATCTGCAGAGGACTAAAGAGTATC
ACGACTGCATCAGTGCCATGGAAGCCCTCTTTGAACAGGT
GTCAAAGGAATGGGACAACCTGGCCAGAACTGATGCTGAA
AGTTCATCTGATCATCTGGAGGCTCTTCGGAAGCTCTCAG
TTGTTCTTAAAGACAAGAAAAGCACACTTGAGGATCTCAA
AGAGCAGAAGCAAAAAGTAATGTACCATCTAAACCTGGAT
GACAAAGAGCTGGTAAAGGAGCAGATAGGCCACTTTGAGC
AGCGATGGGCTCATCTAGAGAGCCTCATTGAGAGGAAGAT
CCAGGACTCCATTTTGACACTTGAAGACATGGGGCAAGTC
GAGGCCTGTTTGAGGGAAGCTCGTGAATGGGCCGAGGAGC
AGCAGCCGACTCTGTCTGAAGCCATGAAGATGAGTCCCCC
ACCGGAGCTAGCGCAAAGTTTCCTCTTTGACCATCTCAGT
ATATGCAGCGAGCTGGAAGCCAAGCAGCTTCTGCTGGCCC
AGGCGATGGGTGATGCAGACAGAGTTTTAGCACATCTGGG
GCTAAATGAAAGACAAAGACTGCAGCAGCTTATCTCAGAG
ACGCAAGCAGAAGTAGAGTGCTTGAGCGTCAAAGTAGCTC
AGCGTAGGAAACACCTTAGCAAGGCTTTCACCGAGAGAAC
ACAGTTCTTGTTGGCTGTGAATCAAGCGATTACCTGGGTC
CAGCAGAATGAGAAGAAAGCACAAGCAGAAGAGTACATAG
CCCTTCTTCCTGACGACCTTTCAAAGCAGGTGAGAACATG
CCGGAACATCCAGAGCAGTTTGAGAGCCTACCAGAGTGAG
CTGACCTCCCTGTGGTCACAAGGCAGGGATCTGATGAAAG
ATGCTTCTGAAGAGGAGAAGACAGAGATGCTTCATAAGCT
CCAAGAACTGCAAAGTATCTTTGAGGTTGCCCTGCAGAAG
TGTAGCCAGAGGCTTCAGGACCTGGAAAAAGTGTTGGTGA
CTAGAAAATACTTTAAGGCAGATTTGGAGAAGATATGCCA
ATGGTTGAAACAAGCCGATATTGTGACCTTTCCAGAGATA
AACCTCATGAACGGAGATGCAGAATTATGCTCACAGCTTA
CAAAATACCAACAGATATTGGATCAAGCTATGGAATTTGA
GAACCTCCTGCTAACTGTGCAAAGGACAGGTCAAGAGATA
CTTCCCACTCTCAATGAAGTAGACCACTGTTACTTGGATG
AGAAATTGATTGCTCTTCCTCAACAGTACAATAATATCTT
GGGACTAGCTAAAGAGAAACAGGAGAAAATACAGCAAGCC
ATTCTTGCCCGACAAGAATATGCCTCCTTCATTGATGTTA
CCCACAAAGCACTTAAAGAACTTGAGGAACAGTTTCACAG
CTTGGGGACGCAGCCAATCGGCCTTAAGACTGAGGAAGTT
GTAAGCCTTCAAGCTGACTACAAAGCCCTTCTGGAGGAGC
TGACCAATCTTGGGCAAGCTGTCGGTGAACTTAACCAAAA
GAAAGAAGGATTCCGAAGCACCGGTCAACCTTGGATGCCT
GAAGAAATGACGCAACTGGTTAGCCTTTACAATGGACTCA
AAAGATTAATTGAACAGAGGGTAGAACACCTTGACGACAC
TCTTGAATCTTTCGAGGACCATCAAGCCATGGCTATGCAG
GTTGACTCAGAGCTGAAAGCCACCAAAGAGCAACTGGTGA
AAGTCAATGCCGAGACACAGTCGGCTGAGGAGAGGTTGAA
GAATTATCATGCCCTAGCTGCTAGTCTTCAAGGTGCCAGC
TCTCACCTCACTCGACTGATGGAGCAGATGGATAACCTGG
TATCCCACATGGATACTGCTGCACATGAGGTTTCAAAACA
GCGGGTGACCTCTTGGCAGGAAGAGCTTCGGTCCTTACAG
TCATCTGTTGGAGAGCTTATTGTGGAGTGTGAGAACAGGT
TCGTGCAGAGTAAAGACTTTGAAACTGAAGTCAATCGGAC
CTTAACCTGGCTCCAACAAATCAAAGATGAACTTGGCTCT
GAGGTGGTGGTAGATGTCAAAGTTGAGAAGGTCCAGGAAG
AAATCCGAAAGCAACAGATCATGCAAGAGGAAGTACAATC
AAGGCTGAGGATAGTGGCAGCTTTGAGTACAAGAGAGAAA
CAGAAATACACCAGTGCCAATGAGCTTGTCCCTGCTCATG
TGGATTCGAGTCTACAAGAGATGGCCAAGCTGGAGGCTGA
TGTTCAGCGTGCCCTAAGCTCTAAACAGATTACATTAGAG
CAAGCTCTTGTCTTGTGCCAGAAGTACCACTCCAGAATGC
AAGCAGCATGTGAGTGGCTTGAGGATGCTGTGGGCTTTTT
GCAGCAGGCCAGTCTTGGGGTGGATGTAGAGAACTACGAG
GAGTGTCTGAGGCAACAAGAGGACATCATGGCCACTGAGC
AAGAGTTCCTGGGGGTTCTCGAGGAGCTGGAATCTCTGCC
ACCGCAACTTGAAAACCTTGTCAACCCTACAGCCAAAGAG
CAGCTTCGACTGAGTGTGGAGTCTGCACAGCAAAGAGGTG
TGGAGGTCAGAGACCAGCTGCAGTGCCACCAAGACGTCTT
AAACAGCTGTGTTGCTCAGTGGAATTCTTACCAAGAAGCC
AGACAGACAGTCATTGACCTGATGAATGAGGTGGAGAAGA
AGTTAACAGAGTTTTCCACAGCCAAGGCTGCAACAAACCA
GGAAGCTGAAGAGAAACTTAGGAGCCATAAGTCCTTAGTA
TCAATGGTGAACAGTTTCCAAGAAAAATTGACCGGTCTGG
AGGAGCAAGCATCCCAGTTAGAGCAGATTGGAAGTGACGC
CAGTAAAGCAACTATAAGTCGATCCATGACCACCGTGTGG
CAGCGCTGGACCAGGTTACGCAGTGTAGCACGAGGCCAAG
AAAGGGTGCTGGAGGACACGGCCCATGAATGGAGGACTTT
CAGAGAAAAGATGATGAAGGTAAGATCTCTAACGGAAGAA
GTGAAGGGCCGTGTTCCTGATTGCACCGCTGAAAAAGCCT
CCAAAGCCACACTGCAGTCACATCTGGACCAGTACGAGCT
GGTTAGTCAGGATCTGGAGAGGGAGCTGTCGTCTCTAACT
CTCCTGAGACAGTACGCTCTTAGTCTGCTACATGACGTGG
AGGTGTCTGTGCCAACGGCTGATCATGAGCAGCTGCCAAG
TCTGAAGGAGATCAAAGCTGTGCAAGATCAACTGGAGAGT
CTCCTGCAGAAGGCCAGGGCAGGAAAATCTCGGGTTCAGC
AGGAGCTGTCAGACAGAGAAGGTGTAGAAAGAGGACTAAG
TCTTGTCAAGAGCTGGATCCAAGACTCCAGAGAGCTCCTG
CTGAACCCCACGTCTGACTTGGACATTCTGTCTCAAGAAC
TGGAGGTGATGCACGGAGAGCTGATCACTCACCGTCAGAA
TGTGGACAAACTCGCAGAGCAGCAGCAAAGCAAATACTTA
GACCTGTACACTATTTTACCATCTGAGATCTCAATGCAGC
TTGCTGAAGTATCTCTGGCGCTGGGATCCATTGAGGATCA
GGTTCAAGCCAGGGAGAGAGACATCCAGAAGTCTAGAGTA
ATCAAAGAAGAGTTCAACTCCAGAATTCATGATGTATCTG
AAAAAATGAAGGCTGTCTCTACTGCTCTAAAGGAAAAGGC
AACGGATATTGATCAGGCCAAAGATGAGGCCAGACGTCTC
TGTGATGAACTTGACTGCTGTGGAAGAACTCTTGCTGAGC
TGGAGGCTGCGGTGCAGGATTTTGGTCGCCGTAACCCTCT
GATAGCCAGACAGCTGGCTGATGCTATCGCTAAATTACGA
GAGATCCATCATCACACTCTTCGACTGGCTGATTATAAGA
CTATATGGCTAAAGAAGGCTGATGCACATCTCGATGAGTA
CAATGAGATGTTTGAGTTCATAGTGAAGTGGACAGACCGA
GCCAGGAGCCTGGTGAAGGCCAACATCATCTGGAACTCTT
CCTCACACCTGCAAGAGCAGATCAGGATGTATCAGGCTGT
TCTGCGTGAGTCACGTGAGCTTCATGGTGACCTGGACTCC
ATGCAGGAGAAGGTGGAGATCCTGTCTGAGACACTGCAGG
TGGAGGCAATGGGACAGCAGGTGTCAGAACTGAGCCGTCA
CACGGAAGAGCTAGAGCAGAGCATCAGATCACGACTGCAA
AGTCTACAGGATGCAGCAAAGGATATGGAGAAGTTTGAGA
GTGAAGTGAAGGTCCTACATGTGTCTCTGGACCAGGTTCA
AGCGACTCTCACGTCTCCTGAACTGGCCCGACTGAGTCTA
AAAGAGCAACTTGCTCAAAGACAGCGTTTGCTGGCAGACA
TGGAGAGCTTCAAGCAGCAGGTGGAGGCCGTGCAGGAGTG
TCAGAGCGCTCTGAGAGTCCCAGAGGAAGTGGTCACCAGT
TTGTCCATCTGTCGCACAGCTCTGAATCTGCAGCAGGAGG
CCAGTCAGCTGCAGCACACCGCCATCCAGCAGTGCAACAT
CCTGCAGGAGGCTGTGGTACAGTATGAACAATACGAACAG
GAAGTGAAAAACCTGCAAGTTATGATTGAAGATGCTCATC
GGGTCATTCAGGACCAACCTGTGAACACCAGCAACATCCA
AGAGCTGCAGGCACAAATTAACCATCACGAGGAACTGGCT
CAGAAAATCAAGGGCTACCAGGAGCAGATCGCGTCCCTAA
ACTCCAAGTGTAAGATGCTGACGGTGAAAGCCAAACACGC
CACCACACTCCTGACAGTGAGTGAAGCAGAGGGACTAACC
GAGAGTCTGGAGGAGCTGGATGGTGAACTCATTAAAAGAA
AATCACAAGCGCAAGTCTCTATGTCCATGGGAAGGTCAAG
TCTCACCAGAGCGCCGGTCCAGGAGCTGTACAATCCTGCA
CTGGAGTCTGTGGCCAGTTTAGATGATCTCCAGCGCTCAT
GGGAGACCCTGAAAAATGTGATAAGTGAAAAGCAGAAGAC
GCTCTACGAGGCTCTGGAGAAGCAGCAGCGCTATCAAGGC
TCTCTCCAGTCCATCTCCAGTAAAATGGAGTCAATCGAGA
CCAGATTAAATGAGCCACCAATGCACGATCTCAGTCCTGA
CAGACAAATGATCCTACATCAGAATCAGATGGAAGAGATC
ATCAGACTGCAGGATGATATCCATGAGCTCCAGTCGAGCT
TTACTGAAGAGCTCTACAATCCTGATTCTGTGGATTCAGA
CTCTGCCGATCAGCTGGCCATGCAGTCCTCGCTCACTGTG
CTGGCGGAGAGAATGGCCACCATACACATGAAGGCTTCTG
GAAAACGGCAAATTCTTGAGGAGCGTCAGAGTGAGCGTGT
GGAAAAGCAGCAGCAGGCGCAGGCTTTACAGCACTACCTC
AACCAGGCAGACCAGCTCGACCAATGGCTGAAGAGCACTC
ACGGTTACATCACTTCCTGCTCTCAGGACTCAGATGCAGA
AGAACAACTCACAGACTGTCAGAACATGCTGCTGGAGATG
GAGGAGAAGGTGCTGGCTCTCTCCGAGCTGTCCCGGCACA
GCGAGAGTCTCCTGCTGGAGGGCCGGCCCGAGAACAGGGA
GGACGCCGAGCAGCTGGCCCGGAAACTGCGCACGCTGAAG
GGGAGCCTGCTGGAGCTGCAGAGGATGCTGCAAGACAAGC
AGATCAACCTGCAGGATTCTCTTCAGGAAGCATCAGACTC
GAGTGAATCAGACTCCACTCTCTCTCAGAGTCCAAACATG
CAGGACTGGCTGGCCCAGGCCCGCACCACACGCAGCCTCC
AGCACCAGGACACCCTCCAGAAACAGAAGGAGCTTGAAGA
GCAACTCGCAGAGCAGAAGAAGCTGTTGAAGTCTGTAGCG
AGTCGTGGAGAGGAGATTCTCACACAGCAGGCGTCACCCG
TCAGAGCCAGCGCGACAGAGACGCTTTCTCCTGATGTAGA
GCTGGAAGGAGACAGTGAGGCTGTGAAAAAGCAGAGGAGA
AAGAGATGGGAAAGCCTGAAGAAAGACATGACCACCAAAT
TACAGCTCCTTATGAACACCCTGGAGCAGGACAGCAAACA
ACCGTTTTACTCCAGAACTGCTTGTGTGAAGACAGCAGCT
CCAGTTTACAAGAGAGAGACACACGTCCAGGACAAGTCCA
ACCTGATGTCCCTGCACAATGGATTCAGTCAGACAATACA
GGAAATGACACCTCAGGCCACAGAGCGAGAGGTCATTCTG
ATGGAGCAGCAGCTTTATTCAGCCGTCACAGCCACTTCTT
CTTGGGTGGATGATGTGGAGAACACACTGTTTTCTGGCCC
TGCGCTGCTCACGGAGAACGCAGACACACAACTCTCCAAC
CACGAGACTCTGGGTAAAGAAGTGACGGAGGTGACGCAGG
AGGTGGGACACACTCAGGGGTTGATCAAAGGATCTGTGGG
TCTGTCTGAGGACGAGCAGAGCCTGATGAAGGACACTCTG
GACTGCCTGACCCGACGCCTCGGAGCCCTGGACTCAGCTC
TGGACCGCCGCTGTGACTCCATGCGGAGCAGAATGAGGGA
ACTCAGCGCTTTCCAGACGGAGCTGCAGCGTCTCTTTACA
GCTCTCAGTGAAAGCAAGTTTCAGATTATCCAGAAAATGG
CAGGAGTTCTTGACCACACAACAACTAAACAGATTGAAAC
CATTGCAGAGGCAGAGGAGACACTGAAAGACTTTGAGCAC
AGAATAACAGAGCTGAAAGCCAGAGGGGCGGAGCTACAGC
CAGACCAGTTCTCCACCAATGAGCTGCTGAAACTCCAGGA
TGCTTATGAGGAGCTAGTGATGACGGTGGGCTCGAGGCGG
AGTGGACTTAACCAGAATATGGCTCTGAAGAATCAGTATG
AACGAGTTCTGCAAGATCTGATTGATCTGGTGGACACAGC
TCAGGATAAGATGACAGCTGACCAGAAGATGATCGCCGCC
TCAGTAGAGGACGTGCACAACCTTCTAGACAAACACAAGG
AGTTTTTCCAAGGCTTAGAGTGGCACATGGTCCTTACCGA
GACGTTTTACAAGAAAAGTAGTGCCTTTGTTTTGCCGCGT
GAGCGTCAGACTCTTGAAGAGACGCTGGCTCGTGCTCAGG
ATGTGCTGAAACAAGCGCATAAAAAAGGAGTTGAGCTGGA
GTGCGTCTCTGAGACATGGAGTCGTCTAGTTTTGGACTAT
CAGACACTGTACCGACTGCTAGAGGTTGTGGAGGGGAGTC
TGCCGAGCGTCGGACTGGTGGAAGAGACAGAGGAGAGACT
TAATGAAAGAATACAGCTATATCAGGCTCTAAGATCCAGT
CTAACGGAGCACCAACACAAGCTCCATCAGGTTCTGGAGG
AGGGAAAACATCTTCTGTCGTATGTGAGCTGCTCGAGTCT
GGAGAACCAGCTGACGGTTTTAGGAGAACACTGGCTCAAC
AACACGACTAAAGTCAACAAGGAGCTGCAGAACCTCCAGT
CCATGTTGAAGCATTTAACCAGGTATAAGAGTGAGTCTGG
TGAACTGAGCCGCTGGTTACTGGAGGCTTTGGAGCGTTTG
GAGTTCTGGAACACACAGTTTGTTGCAGGACCTCAGGAGC
TGGAGACTGTTAAAGGCCAGCTGTCGGCTTTTCTGGAGTT
CAGCAAAGAGGTGGAGGCTCGCTCCAATCTCAAGGCCTCA
GTGCTGAATGAGGGAAACCAGCTTCTCAGGCTGAAAAAGA
TGGACACGGCGTCTTTGCGGGCTGAACTGGCCTGTCTGGA
CTCTCAGTGGTCTGAACTGCTTTCCCGCATTCCCATAGTT
CAAGAGAAACTCCACCAGTCTCAGATGGATAAGCTGGCAT
CCCGTCATGCTATAACAGAGCTGGTCAACTGGATTTCGCT
GATGGAGAGAGTGATAGAAGAGGATGAGGAGAATCTGAAA
GGGGCTGTCGGGTCAAAGGTCATTCAAGAGTACCTGCAGC
GATATAAGGGCTTCAGGGTGGATGTGAACTGCAAACAGCT
CACTGTGGACTTTGTTAACCAGTCAGTGCTCCAGATCAGC
GGTGCGGACGTCGAGAGCAAGCGCAGTGATAAAACTGATT
TTGCTGAAAAACTGGGCGCCATGAACTGCCACTGGCAGAT
CCTGCAGACACGCATCACAGAGAGGGTGCAGTATCTGGAA
GGCTTGTTGACATCTTGGGTGGAATATGAGGGTAAGGTTC
AGGGTCTGCAGGCGTGGCTGGATGCTCAAGAAGAAAGGCT
CAAGAGGAAACACAGGATTGAGAACTTATCTTCTGTGCAA
AATGCACTCAAAGACTGCCAGGAGATGGAGGTGATGGTGA
AGGAGAAAGAGAGAGAGCTGGAGAGAGTGGAGGAACAGGC
CTGTGCTCTCGTCCAAAACAAGACGGACGAGGCCTGTGCT
GTCGTGATGGAGTCTCTACGAGCCCTCAACAACACATGGG
CCAATCTGGACCACCTGATCGGGCAGCTCAAGATCAGCCT
GAAGTCTGTCCAGGACAAGTGGAATCAATACAAACAAGCG
TCTGAGGAGATTAACGGGTACCTGACGGAGGGCCGCTACT
CTGTGTCCCGCTACCGTCTGCTCACGGGCTCTCTGGAGGC
GTCACGACTGCAGGTGGAGAGTCTGCAGAACCTGCAGGAG
GAGCTTGAGAAACAGGAAAGCAGCATGAGAAAGTTTGGAT
CGGTCACACTTCAGCTTCTGGAGGAGTGTCACCCGTCTGT
GTCTGACACACTCAATAACACACTCAAAGACATCAATGCT
AGGTGGAGCAGTCTACAGGAGGAGATCGTGGAGCGTCTGA
AGAGCAGTAAAGCTCTCCTGCAGCTCTGGCAGAGCTATAA
AGATCTTTATGGACAGAGCGACTCCAGCGTTCAGACACTG
GAGGAGAAAGCCAACCAGATGCTAAAGACAGCTAGCCATA
AAGACATCACAGAGGAGGAGGTGTCTGCCTGGATTCAAGA
CTGTGCTGAGCTACTGCGCTCTCAGGCTCCGGTTCAGGCG
TCTCTGCAGGTTTTAATGGAGTTAGGAGAACAGCTCAAGC
AGCAGGTGGACACATCCGCTGTGGCCTCCATCCAGTCAGA
CCACCTATCTCTCACCCAGCGCCTCAGTGTGGTGGAGCAG
AGCCTGAGTCGACAGCAGGTGGCGCTGCAGGCTGGAGTTC
GGGACTATGAGACGTTTAATGAGCAGCTGGACTCTCTGTC
CCGCTGGATTGTGGAAGCTGAGGAGGTTCTGAAAGGACAA
GATCCCAATGGATCATCTGACCAGTCACTGATCCAAGACC
GCATGGAGGATCTAAAGAAACAGATGCTAAAGTTCAGCAG
TATGGCTCCTGATCTGGAGAGACTGAATGAACTGGGTTAC
AGACTCCCACTGAACGACTCTGAGATCAAGCGCATGCAGA
ACCTCAACAGAAGCTGGTCCACAACTTCAGCTCAGACCAC
CGAGAGATTCTGTAAACTTCAGGCGCTGCTTCTCCAGCAG
CAGACATTTCTGGAGAAGTGTGAGACATGGATGGAGTTCT
TGGTGCAGACGGAGGAGAAACTGGCCGTGGAGATTTCCGG
AAACTTCCAGAGCCTGATGGAGCAGCAGAGAGCTCATGAG
CTGTTTCAGGCCGAGATGTTCAGCAGACAGCAGATCCTTC
ACTCCATCATCAGTGATGGACAACACATGCTGGAGCAGGG
ACAGGTGGATGACAGAGATGAGTTCAAGCTGAAGCTGGCT
CTGCTCAGTAACCAGTGGCAGGGTGTGGTGAGACGGGCAC
AGCAGCGACGGGGCATCATCGACAGTCTCCTGCGCCAGTG
GCAGCGCTACCGGGAGATGGTGGAAAAGCTTCGCAAGTGG
CTGCTGGAGGTCAACCATCAGACCCAGAGCCTGCAGGCGG
GGACACCAGTGCCACTGCAGCAGGCACGAGCCATGCTGGA
TGCAGTTCAGCTCAGAGAGAAGGTTCTGCTGAGACAGCAG
GGAAGTTACATTTTGACAGTGGAGGCCGGCCGACAACTGC
TTCTGTCTGCTGATTCTCGAGCTGAAGCCGTTCTACAAGA
GGAGCTGCTCAACATTCAGGAGCGCTGGAGAAATGCCAAC
ATCCGCCTGGACGAGCAGAAGAAGGAACTGGCCGTCCTGC
TCAGGGATTGGGAGAGATGTGAGAAAGGAATCGGAGGATC
TCTGGAGAAGCTGAGAGCTTTTAAACGACAGCTTTCACAG
CCGCTGCCAGATCGCCACGAGGAGCTGCAGGCGGAACAGA
TGCGCTGCAAGGATCTGGACAGCATGTTTGACGGCTGGAA
GGAGGATTTGACACATCTGACGGTGCTGAGAGAGTCTCTG
TCCAGCTACATCAGTCTGGATGATCTACGTGTGCTGCAGG
AACGCATCGAGCTGCTGCACCGCCAGTGGGAGGAGATCTG
TCACCAGCTGTCTCTGCGCAGACAGCAGGTGAGCGAGAAG
ATGAATGAATGGGCCATCTTCAATAACAAATACAAGGAGC
TGTGTGAATGGCTGACACAAATGGAAAGCAAAGTGTCCCA
CAATGGAGACGTCAGCATCGAAGAGATGATTGAGAAACTG
CGCAAGGACTATCAGGAGGAGGTGTCTGCGGCTCAGGAGA
ACAAGCTCGAACTCCAGCATCTGGGTGAACGATTAGCTCG
AGCCAGTCATGAGACCAAAGCCTCTGACATTGAACACAAA
CTTAGCAAAGTCAACGAGCGCTGGCAGCACCTGCTCGACC
TCATAGGAGCCAGGGTGAAGAAGCTGCGGGAGACTTTGGT
GGCCGTTCAGCAGCTGGATAAGAACATGAACAGTCTGCGC
TCTTGGCTTGCTCACATCGAGACTGAACTGTCTCGTCCCA
TCGTCTACGACACCTGCGACTACCAGGAGATCCAGAGGAA
ACTCGATCTGCAGCAGGAGCTGCAGAGAGACATTGAGAAG
CACAGCACTGGTGTGGCGTCTGTGCTGAATCTGTGTGAGG
TTTTACTGCACGACTGCGACGCCTGCGCGACAGATGCGGA
GTGCGACTCCATCCAGCAGGCAACACGCAGCCTGGACCGC
CGCTGGAGGAGCATCTGCGCCATGTCCATGGAGAGGAGAA
TCCGGATTGAGGAGACGTGGCGTCTCTGGCAGAAGTTTCT
GGATGATTACTCTCATTTCGAGGAGTGGCTGATGTTGTCG
GAGAAAACAGCCGCTTTGCCAAACTCTTCAGGTGTCCTTT
ACACTATTGCCAAAGAGGAGCTCAAGAAATTCGAGACGTT
CCAGCGGCATGTGCATGAAAGTTTGACACAGTTGGAGCTG
ATCAACAAACAGTATCAGCGACTGGCACGTGAGAATCGCA
CCGATGCAGCCTGTAGTCTGAGAGAAATGGCCCACAATGC
CAATCAGCGCTGGGATAACCTGCAGAGAAGAGTGTCATCC
GTCCTCCGGAGACTGAAGCACTTTATCAGTCAGAGAGAGG
AGTTTGAGACGGCGCGGGACTGCATCCTGGTCTGGCTGAC
GGAGATGGACCTGCAGCTTACCAACATTGAGCATTTCTCT
GAGTGTGATGTCCAGGCCAAAATCAAACAGCTCAGGGCGT
TCCAGCAGGAGATCACACTGAACACGGGCAAGATCGACCA
CATATTCCTGCAGGGTGAAGCTCTTCTGGAGAAAAGTGAG
CCGATCGATGCTGCTGTGATCGAGGAGGAGCTGGAGGAGC
TGCAGAGATACTGCCAGGAGGTGTTTGGACGTGTGGAACG
ATACTACAAGAAACTTATACGATTACCGCTGACGGACGAT
GAGCATGACGTCTCGTTCTCAGACCGGGAGTTTGATCTGG
ATGAAGCTGCTGACGTGTCCAGCTTCCCCTGGAGCGAGCG
TTTGGGGGATGGTTTTCTGTCTCCTCTGCCATCCTCCAGC
CGATCTGCTCCGCTGCGGGCCGAACGCTCTGGTCGGGACA
CTCCGGCCAGCGTCGACTCCATCCCACTGGAGTGGGACCA
CGATTATGACCTGAGCCGTGGTCTGGAGAGCGCCAGCAGG
GCCCTCTCCTCTTCCGAAACAGGAGATCAGGCAGAGGATG
ATGGGTACCTGCAGGGCTCAGCATCTGCACTCTCAGGTGA
CGCCGGATCTCTGGAGACTCACATCCGACAGCTGGATAAA
GCTCTGAACACCAGCTGTTTCCACCTGCAGCAGACGGAGA
ACATCATACGCAGCCGAACGCCCACCGGCCCCGAGCTGGA
CGCCACATACATGGGTTATATGCGTCTCCTTGAAGAATGT
CGTGGCAGTATTGATGCTGTAAAGCGGGTGGGATTTGAGC
TGAAAGATGAAGACGACAAGATATCAGGCTTCGTCAATCC
CAACAGCTCAGAGTCCCAAACATCAGGAGTGATCGAGCGC
TGGGAGCTTCTGCAGGCTCAGGCTCTCAGTAAAGAGATGC
GCATGAAGCAGAACATGCAGCAGTGGCAGCAGTTCAACTC
CGACCTGAGCAGCATCTGCAGCTGGCTGGACCAGACAGAA
GAAGAGCTGCAGCAGGAGCGGGGACTGGACCTCGGAACAG
ATATACAGACCATTGAGCTGCGCATCAAGAAGCTTAAGGA
GCTGCAGAAAGCTCTGGATAAGCGTAAGGCCATCGTTCTG
TCCATAAACCTCTGCAGTGCTGAGTTTGTGCAGTCAGACA
GCGAGGAGGCTCGAGAACTGCAGAGGCGGCTGAAGGAGAT
GAACAACCGCTGGGAGAAACTCAGCAGCTCTCTGGACGAG
TGGAGGACTGCGCTCCAGCATGCACTCATGCAGTGCCAGG
ATTTCCATGAGATGAGTCACGGTCTGCTTCTGTGGCTGGA
GAACATCGATCGCAGGAGAAATGAGATCGTCCCGATTGAC
CACACTCAGGACAGCGACACCCTACAAGAGCATCACAAAA
CACTGCTGCAAATCCGACGGGAGCTGCTGGATACGCAGGT
GAAGGTGGCGTCTCTGCAGGACATGTCCCTTCAGCTGCTG
GTTCACTCTGAGGGCAGCGACTGTCTGGAGGCCAAAGAGA
AGGTGCATGTGATCGGGAACAGACTCAAACTGTTGCTGAA
GGGGGTGACCAGAGACATCCGAGAACTGCAGAAAACACTG
GACATCAGCAGCAGTCAGCAGGATTTATCCTCCTGGTCAT
CTGCTGATGATCTGGATACATCTGGATCTCTGAGCCCTGT
GTCTGGACGCAGCACACCGAGCCGCCAGCGACCGCCACGG
GGCAAAAGTAGTGTGTCAGAGCCTGGAGCCTGTGTGAGCA
GTCTACTTCACAGCAGGTCTCTCAACGCCGCTGGATCCGC
TTTCTCCCATTCTGAAGATGAAGAGCGGCCATCTTGGTGC
AGAAGCTTCCTGAAGCGGGTCTTCTGGGCCGCGCTGCCCC
TGCAGATCATCCTGCTGCTGGTGCTGATTGTGGCCTGTCT
TGTGCCTACGTCTGAGGATGGCTACAGCTGTGCCCAACTC
AACAACTTCGCCCGCTCCTTCCACCCAATGCTCAGCTACA
CCAACGGCCCTCCGCCAATATGAGCCAATATGATGGGTTT
CTCGAAATTGACAACTGCCAAAAATGGAGGTTGGCAGCCA
AAGTGAATTATTACGGTGTCCTTGTACAGCTGCTAATCTT
ACCGTCATCAAAAGTCTTGTGTAGATGTTAGAACAAAGCC
TATTGCACTGAAATCTGCTGTGTTAGTGCTACTGATGTTC
TTCCATATTTTGATATTAAGGAGGAAGCTAGAGCGTAACT
CAACACTGGTATTGTTACTGTAAAGGCACTTTCAGTCTTT
CTTAATCATAAAAAAACGAAAACAAAAACTGAAATGTGCG
TGCGTCTTTCAGTATACTTGTAAAAAAGAGAAAATGAAAA
ATATATGAACTCTATATTGCAATTATTTTTTATATGTATT
TTTGGCATGTGGTCATCCTTTGGTTTTAAAAAACGCTCAT
TGATTTTATCGAATTTGTTGTCGGTTTTTAATTTTTGATC
TTAACTAATCTGCTGTAACGTTGAGTTTAATTGTGTCACG
ATACTATACTTTACTCTATGTAAACCACTGATGTCGAAGA
AAAGGATATTTATGTATGTACAGAGTTTGCTGAGGCCTAA
GAAACCTTCGCAATGAAAACATATATGATATATACACATA
ACCTAATGATTCATATTTTTCATTACGATTAAAGAT

syne1b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA syne1b-202 27036
syne1b-203 (1)    Ensembl 870
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
syne1b-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000049930 (1),  Ensembl_Trans:ENSDART00000148520 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:DY570520 (1) 780 bp
GenBank:CF996619 (1) 779 bp
GenBank:BI884847 (1) 581 bp
GenBank:EB933537 (1) 521 bp
GenBank:EB946624 (1) 494 bp
GenBank:EB932053 (1) 493 bp
GenBank:EB940396 (1) 451 bp
GenBank:EB927922 (1) 386 bp
CITATIONS (2)