header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-1538
Transcript Name: syne1b-203
Previous Name: syne1b-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049931 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049931|OTTDARG00000035128|ZDB-GENE-071218-4 syne1b|OTTDARP00000039183 syne1b-002 LG_none BX936315.11,BX511113.8,BX927406.24,CR407704.10 Danio rerio protein_coding KNOWN, 870 bp
CGACGGGAGCTGCTGGATACGCAGGTGAAGGTGGCGTCTC
TGCAGGACATGTCCCTTCAGCTGCTGGTTCACTCTGAGGG
CAGCGACTGTCTGGAGGCCAAAGAGAAGGTGCATGTGATC
GGGAACAGACTCAAACTGTTGCTGAAGGGGGTGACCAGAG
ACATCCGAGAACTGCAGAAAACACTGGACATCAGCAGCAG
TCAGCAGGATTTATCCTCCTGGTCATCTGCTGATGATCTG
GATACATCTGGATCTCTGAGCCCTGTGTCTGGACGCAGCA
CACCGAGCCGCCAGCGACCGCAGGTCTCTCAACGCCGCTG
GATCCGCTTTCTCCCATTCTGAAGATGAAGAGCGGCCATC
TTGGTGCAGAAGCTTCCTGAAGCGGGTCTTCTGGGCCGCG
CTGCCCCTGCAGATCATCCTGCTGCTGGTGCTGATTGTGG
CCTGTCTTGTGCCTACGTCTGAGGATGGCTACAGCTGTGC
CCAACTCAACAACTTCGCCCGCTCCTTCCACCCAATGCTC
AGCTACACCAACGGCCCTCCGCCAATATGAGCCAATATGA
TGGGTTTCTCGAAATTGACAACTGCCAAAAATGGAGGTTG
GCAGCCAAAGTGAATTATTACGGTGTCCTTGTACAGCTGC
TAATCTTACCGTCATCAAAAGTCTTGTGTAGATGTTAGAA
CAAAGCCTATTGCACTGAAATCTGCTGTGTTAGTGCTACT
GATGTTCTTCCATATTTTGATATTAAGGAGGAAGCTAGAG
CGTAACTCAACACTGGTATTGTTACTGTAAAGGCACTTTC
AGTCTTTCTTAATCATAAAAAAACGAAAACAAAAACTGAA
ATGTGCGTGCGTCTTTCAGTATACTTGTAA

syne1b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA syne1b-202 (1)    Ensembl 27036
Select Tool
syne1b-203 870
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
syne1b-203 Contained in:

Genome Resources: Vega_Trans:OTTDART00000049931 (1),  Ensembl_Trans:ENSDART00000148604 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EE315526 (1) 865 bp
GenBank:EE307597 (1) 861 bp
CITATIONS (2)